Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Conservative Substitution: The nucleotide mutation that alters the amino acid sequence of protein, but which causes substitution of one amino acid with another which has a side chain with the similar charge/polarity characteristics. The size of the side chain might also be a significant consideration. Conservative mutations are usually considered unlikely to profoundly alter the structure or the function of a protein, but there are number of exceptions.
Q. What is the significance of the -R group (variable radical) in an amino acid molecule? The -R group, also known as lateral chain, is the variable part of the amino acid mole
Define Instrument for measurement of absorbed radiation-Colorimeter? The simplest types of, photometric instruments are designed for measurements in the visible region of spect
Q. Atrial Fibrillation or Flutter? Transient atrial fibrillation or flutter is seen frequently and can be associated with CAD, rheumatic heart disease, thyrotoxicosis, or myoc
Why can the allantois be considered an adaptation to terrestrial life? The allantois is an adaptation to dry land because in embryos of oviparous terrestrial beings, like repti
What is the need of Monitoring and Surveillance? Monitoring, we know, is the act of observing something and sometimes keeping a .record of it while surveillance is a repeated s
What is the mRNA sequence to this DNA sequence : Guanine, cytosine, adenine, adenine, thymine, guanine
Q. What are the three major cell types that form the osseous tissue? What are their functions? The three major cell types of the osseous tissue are the osteocytes, the osteobla
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. Define Pacinian corpuscules? Pacinian corpuscules are an example of sensory receptors scattered deep in the subcutaneous tissue underlying skin or in viscera. These mech
how many chromosomes in human
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd