Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Class angiospermae (Flowering plants)Flowers are the reproductive structures. Ovules are protected within ovary, xylem vessels are present. After fertilisation the ovary develops into fruit.
What are the common changes in the eye Other changes in the eye are: 1) Increase in curvature of anterior surface of lens. 2) Anterior pole of lens moves forwards without
Explain the Obligatory Losses of Nutrients? Obligatory losses of nutrient are defined as 'the losses that occur when an individual is put on a diet free of that nutrient'. For
Q. List the functions of insulin? a) Insulin controls the level of the sugar (glucose) in the blood. b) Insulin permits cells to use sugar (glucose) for energy. Cells cannot
What are the principal sources of excessive nitrate and phosphate in rivers and lakes?
Protection of Plants against Toxic Substances Plants produce several toxic substances themselves and may also encounter the ones produced by other plants or present in the env
A plant with red flowers is crossed with a white-flowered plant of the similar species. All the seeds, when grown, produce plants with red flowers. Assuming that the flower colour
Bacillary Dysentery: You have learnt about the diarrhoea in the foregoing sub-section, now let us take for example a child who has loose motion which contains blood and mucus
Q. Explain about Malnutrition Related Diabetes Mellitus? This type of diabetes has been categorized as a separate entity. 'if is 'Men seen commonly in developing countries, 1n
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd