Explain cidofovir, Biology

Assignment Help:

Cidofovir (Vistide)

IV cidofovir given once weekly for 2 weeks and then once every 2 weeks for maintenance therapy can delay progression of CMV retinitis in patients with AIDS.

 


Related Discussions:- Explain cidofovir

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

How do fishes do gas exchange, Q. How do fishes do gas exchange? Fishes...

Q. How do fishes do gas exchange? Fishes "breath" through gills, branchiae or Gills, are highly vascularized organs specialized in gas exchange under water and present in aquat

Define the term - peroxisomes and glyoxisomes, Peroxisomes and Glyoxisomes ...

Peroxisomes and Glyoxisomes A number of metabolic reactions, such as, the oxidation of amino acids and lipids result in the production of hydrogen peroxide. As hydrogen peroxid

How to reduce the toxicity of a chemical in the body, Which process may not...

Which process may not reduce the toxicity of a chemical in the body?

Explain the severe burns - clinical therapeutic nutrition, Explain the Seve...

Explain the Severe Burns - Clinical Therapeutic Nutrition? Severe, life-threatening bums require immediate care. Dehydration is treated with large amounts of fluids given intra

What are taenias and diseases caused by them, Q. What are taenias? What are...

Q. What are taenias? What are the diseases caused by them? The Taenias, as well know as tapeworms, are platyhelminth animals (flatworms). The major diseases caused by taenias a

What is the difference among living and non-living things, What is the diff...

What is the difference among living and non-living things? Living things obtain and use energy. They also grow throughout their lifetime. Living this is made of cells. Living t

Explain what is dna, Explain what is DNA? DNA : DNA is the source of t...

Explain what is DNA? DNA : DNA is the source of the information that directs the development of the cell. Although all segments of DNA are not active in every cell in the huma

Explain numeric pyramid base to be smaller than other level, In a numeric p...

In a numeric pyramid is it possible for the base to be smaller than the other levels? Ever since the numeric pyramid represents the quantity of individuals in each trophic leve

Alpha helix and the beta-sheet protein, What is the difference between the ...

What is the difference between the alpha helix and the beta-sheet protein conformations? Ans) Alpha helix and beta-sheet conformations are the two major types of secondary struc

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd