Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain Changes in feeding behaviour of infants?
On maturation of neuro-muscular system, the body is able to coordinate sucking, swallowing and breathing. Till about three month, the baby moves tongue up and down and if a solid food is placed on the tongue, the food is pushed out (extrusion reflex), Between 3 to 4 months, the tongue movement changes and the child is able to swallow. By 6 months, the baby is able to chew.
The psycho social changes determine the feeding pattern. An infant identifies with his mother but a preschooler develops a sense of individuality and imagination. Preschooler is in a period of sex identification and hence boys imitate father and girls imitate mother. Hence, parents should inculcate and display healthy attitudes at mealtime.
Glycogen Storage Diseases Glycogen storage diseases are caused by genetic defects that result in deficiencies in certain enzymes of glycogen metabolism. These deficiencie
What is Choanoflagellate? Explain in brief. The protozoans which resemble the choanocyte cells found in sponges. They have a collar of microvilli which surround a central flage
What are autotrophic beings? What are heterotrophic beings? The Autotrophic beings are those that can produce their own food that is that make organic material from inorganic c
The cost of replacing these indirect uses of biodiversity, even if it were technically possible, would be so high as to render it impossible to duplicate. We also do not know how
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
In the preceding block you learnt the Darwinian premise of natural selection based on certain facts and deductions thereof. You would have noticed that one of the foundations for t
Three charges are at the corners of an equilateral triangle, as shown in the figure below. Calculate the electric field at a point midway between the two charges on the x-axis. (Le
Q. What is Mitral Valve and Coronary Arteries? On the PA view, mitral valve calcification is seen just to the left of the spine, below the position of the aortic valve. The lar
Nonsurgical retreatment (secondary endodontic ttt ) -Is the main difference between primary endodontic disease versus post treatment disease is the need to Regain access to
a) Why do C 4 plants have dimorphic chloroplasts? Describe the different steps involved in C 4 photosynthetic carbon cycle in such plants.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd