Explain changes in feeding behaviour of infants, Biology

Assignment Help:

Explain Changes in feeding behaviour of infants?

On maturation of neuro-muscular system, the body is able to coordinate sucking, swallowing and breathing. Till about three month, the baby moves tongue up and down and if a solid food is placed on the tongue, the food is pushed out (extrusion reflex), Between 3 to 4 months, the tongue movement changes and the child is able to swallow. By 6 months, the baby is able to chew.

The psycho social changes determine the feeding pattern. An infant identifies with his mother but a preschooler develops a sense of individuality and imagination. Preschooler is in a period of sex identification and hence boys imitate father and girls imitate mother. Hence, parents should inculcate and display healthy attitudes at mealtime. 


Related Discussions:- Explain changes in feeding behaviour of infants

Explain glycogen storage diseases, Glycogen Storage Diseases Glycogen  ...

Glycogen Storage Diseases Glycogen  storage diseases are caused by  genetic defects that result  in  deficiencies in  certain enzymes of  glycogen metabolism. These deficiencie

What is choanoflagellate. explain in brief., What is Choanoflagellate? Expl...

What is Choanoflagellate? Explain in brief. The protozoans which resemble the choanocyte cells found in sponges. They have a collar of microvilli which surround a central flage

What are autotrophic beings? what are heterotrophic beings, What are autotr...

What are autotrophic beings? What are heterotrophic beings? The Autotrophic beings are those that can produce their own food that is that make organic material from inorganic c

Indirect uses of biodiversity, The cost of replacing these indirect uses of...

The cost of replacing these indirect uses of biodiversity, even if it were technically possible, would be so high as to render it impossible to duplicate. We also do not know how

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Intraspecific and interspecific competition, In the preceding block you lea...

In the preceding block you learnt the Darwinian premise of natural selection based on certain facts and deductions thereof. You would have noticed that one of the foundations for t

Calculate the electric field at a point midway, Three charges are at the co...

Three charges are at the corners of an equilateral triangle, as shown in the figure below. Calculate the electric field at a point midway between the two charges on the x-axis. (Le

What is mitral valve and coronary arteries, Q. What is Mitral Valve and Cor...

Q. What is Mitral Valve and Coronary Arteries? On the PA view, mitral valve calcification is seen just to the left of the spine, below the position of the aortic valve. The lar

Nonsurgical retreatment -secondary endodontic ttt, Nonsurgical retreatment ...

Nonsurgical retreatment (secondary endodontic ttt ) -Is the main difference between primary endodontic disease versus post treatment disease is the need to Regain access to

Why do c4 plants have dimorphic chloroplasts, a) Why do C 4 plants have di...

a) Why do C 4 plants have dimorphic chloroplasts? Describe the different steps involved in C 4 photosynthetic carbon cycle in such plants.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd