Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain the Changes in Body Tissue Compartments - Underweight?
The severity of nutritional deprivation determines the extent of changes in the body tissue compartments. The first casualties in moderate under nutrition are mainly the visceral proteins and muscle cell mass without any change in body fat. In severe undernutrition, losses of both muscle cell mass and body fat occur to a significant degree. Anthropometric measures and laboratory determination of protein status can predict the extent of changes in the body tissue compartments. A number of micronutrient deficiencies may occur in individuals who are underweight because of the less quantity of food ingested. A starving patient has inelastic skin, slow pulse, low blood pressure, marked emaciation and progressive loss of weight.
Recent molecular analyses indicate that the artiodactyls, which include hippos and camels, are paraphyletic, whereas cetaceans are monophyletic and cetaceans and hippos form a clad
MOUT H - It is as transverse slit. It is pseudo type i.e. not open directly into alimentary canal. Mouth is covered by upper & lower movable lips. Movement is due to arb
Q. What is Deoxynivalenol? Deoxynivalenol (DON) is a far more common, but much less toxic, trichothecene and is produced by species such as F. graminearum and F. culmorum. LD
Define Proteins required for underweight - Nutritional Care? Proteins are required for tissue building, as well as, to take care of the daily wear and tear. Under weight indivi
Pox diseases Small-pox in human beings and pox in a few animal species are closely related to each other. It is shown by the fact that the vaccine for the prevention of small
What are the benefits of high-throughput expression analysis in molecular biological investigations? Ans) These methods permits simultaneous analysis of the expression of a lot
Outline classification of coelenterates
Air pollution affects both living and non-living matter. The effects can be classified as.
Explain the issues related to food production? Let us now understand some issues related to food production, these are: Factors influencing food production, Analysi
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd