Explain changes in body tissue compartments - underweight, Biology

Assignment Help:

Explain the Changes in Body Tissue Compartments - Underweight?

The severity of nutritional deprivation determines the extent of changes in the body tissue compartments. The first casualties in moderate under nutrition are mainly the visceral proteins and muscle cell mass without any change in body fat. In severe undernutrition, losses of both muscle cell mass and body fat occur to a significant degree. Anthropometric measures and laboratory determination of protein status can predict the extent of changes in the body tissue compartments. A number of micronutrient deficiencies may occur in individuals who are underweight because of the less quantity of food ingested. A starving patient has inelastic skin, slow pulse, low blood pressure, marked emaciation and progressive loss of weight.


Related Discussions:- Explain changes in body tissue compartments - underweight

Cladogram help, Recent molecular analyses indicate that the artiodactyls, w...

Recent molecular analyses indicate that the artiodactyls, which include hippos and camels, are paraphyletic, whereas cetaceans are monophyletic and cetaceans and hippos form a clad

Digestive system - mouth, MOUT H - It is as transverse slit. It is ...

MOUT H - It is as transverse slit. It is pseudo type i.e. not open directly into alimentary canal. Mouth is covered by upper & lower movable lips. Movement is due to arb

What is deoxynivalenol, Q. What is Deoxynivalenol? Deoxynivalenol (DON)...

Q. What is Deoxynivalenol? Deoxynivalenol (DON) is a far more common, but much less toxic, trichothecene and is produced by species such as F. graminearum and F. culmorum. LD

Define proteins required for underweight - nutritional care, Define Protein...

Define Proteins required for underweight - Nutritional Care? Proteins are required for tissue building, as well as, to take care of the daily wear and tear. Under weight indivi

Pox diseases, Pox diseases Small-pox in human beings and pox in a few ...

Pox diseases Small-pox in human beings and pox in a few animal species are closely related to each other. It is shown by the fact that the vaccine for the prevention of small

Benefits of high-throughput expression , What are the benefits of high-thro...

What are the benefits of high-throughput expression analysis in molecular biological investigations? Ans) These methods permits simultaneous analysis of the expression of a lot

Adverse effects of air pollution, Air pollution affects both living and non...

Air pollution affects both living and non-living matter. The effects can be classified as.

Explain the issues related to food production, Explain the issues related t...

Explain the issues related to food production? Let us now understand some issues related to food production, these are: Factors influencing food production, Analysi

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd