Explain casein, Biology

Assignment Help:

Explain Casein

Casein is an important example of protein, which can be boiled without apparent change in stability. The exceptional stability of casein makes it possible to boil, sterilize and concentrate milk, without coagulation.  

 


Related Discussions:- Explain casein

What are the plant root hairs, What are the plant root hairs? Where can the...

What are the plant root hairs? Where can they be found and what is their function? The root hairs are external elongated projections of the root epidermis. Their role is to

Embryonic development, Embryonic Development The embryonic stage exte...

Embryonic Development The embryonic stage extends from the second week by the 8th week and is charactrised by formation of placenta, the development of internal organs and ap

What is difference between analogous and homologous organs, What is the dif...

What is the difference between analogous and homologous organs? The Characteristics of different species are said to be analogous when having the same biological function, for

Bacterial artificial chromosome (bac), Bacterial artificial chromosome (BAC...

Bacterial artificial chromosome (BAC) is a chromosome-like structure, made by genetic engineering. BAC is a cloning vector able to carrying between 100 and 300 kilo bases of targe

PLASMODIUM LIFE CYCLE, elucidate a life cycle of a plasmodium that causes m...

elucidate a life cycle of a plasmodium that causes malaria

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain coenzyme a, Coenzyme A Coenzyme A  is  derived  from  the  vita...

Coenzyme A Coenzyme A  is  derived  from  the  vitamin pantothenic  acid. This  is abbreviated  as CoA.  This  can  be  divided into  two  components, adenosine  3,5-diphosphat

Planning the nursing care for infective endocarditis, Planning the Nursing ...

Planning the Nursing Care   Provide bed rest  Administer antibiotics as advised Prevent infection  Implementation of Nursing Care  Provide Bed Rest   Sin

Can you explain mitotic apparatus, Q. What is mitotic apparatus? Mitoti...

Q. What is mitotic apparatus? Mitotic apparatus is the set of aster fibers, radial structures around each centriole pair, plus the spindle fibers, fibers that extend across the

How do contraceptive pills generally work, How do contraceptive pills gener...

How do contraceptive pills generally work? Contraceptive pills generally have the hormones estrogen and progesterone. If taken daily from the 4th day after menses the abnormal

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd