Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain Casein
Casein is an important example of protein, which can be boiled without apparent change in stability. The exceptional stability of casein makes it possible to boil, sterilize and concentrate milk, without coagulation.
What are the plant root hairs? Where can they be found and what is their function? The root hairs are external elongated projections of the root epidermis. Their role is to
Embryonic Development The embryonic stage extends from the second week by the 8th week and is charactrised by formation of placenta, the development of internal organs and ap
What is the difference between analogous and homologous organs? The Characteristics of different species are said to be analogous when having the same biological function, for
Bacterial artificial chromosome (BAC) is a chromosome-like structure, made by genetic engineering. BAC is a cloning vector able to carrying between 100 and 300 kilo bases of targe
elucidate a life cycle of a plasmodium that causes malaria
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Coenzyme A Coenzyme A is derived from the vitamin pantothenic acid. This is abbreviated as CoA. This can be divided into two components, adenosine 3,5-diphosphat
Planning the Nursing Care Provide bed rest Administer antibiotics as advised Prevent infection Implementation of Nursing Care Provide Bed Rest Sin
Q. What is mitotic apparatus? Mitotic apparatus is the set of aster fibers, radial structures around each centriole pair, plus the spindle fibers, fibers that extend across the
How do contraceptive pills generally work? Contraceptive pills generally have the hormones estrogen and progesterone. If taken daily from the 4th day after menses the abnormal
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd