Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain Bidirectional Superior vena cavo pulmonary shunt bidirectional glenn
"This is a palliative produce where blood from superior vena cava is diverted to the pulmonary artery. As the pulmonary artery bifurcation is preserved, the superior vena caval blood will flow to right and left pulmonary arteries. In the original Glenn shunt, the superior vena cava, and pulmonary arteries were divided and then end-to-end anastomosis done. The entire superior vena caval blood was diverted to the light pulmonary artery. Bidirectional Glenn (BDG) is a superior operation because the SVC blood flows into both pulmonary arteries.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Some organisms contain enzymes that condense a fatty alcohol and a fatty acid to generate wax esters. Draw decanol, plamitic acid (C16:0 fatty acid) and the resulting wax ester gen
what major nerve do you think is being compressed when a person often feel pain in the posterior surface of the thigh radiating to the area behind the knee and where is the likely
Q. Periapical radiography - criteria for endosteal implants? Periapical radiographs are images of a limited region of the mandibular or maxillary alveolus. Periapical radiogra
State the Definition of Temperature Temperature may be defined as degree or amount of body heat. It is the balance between heat produced and heat lost by the body. It is meas
economic importance of the phylum protozoa
Q. Which type of polarity do water-soluble and fat-soluble substances respectively have? Water-soluble substances are polar molecules that are they have electrically charged ar
Amoeboid Tapetum - Tapetum It is also known as invasive or periplus modial tapetum. This type of tapetum is more prevalent in the monocotyledons (Arum) than in the dicotyledon
Adaptive radiation OR convergence Adaptive radiation Explanation of the adaptive radiation process linked to the introduction of a single species and the wide range
What is the name of the DNA duplication process? What is the main enzyme that participates in it? The process of copying, or duplication, of the DNA molecule is called replica
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd