Explain bidirectional superior vena cavo, Biology

Assignment Help:

Explain Bidirectional Superior vena cavo pulmonary shunt bidirectional glenn

"This is a palliative produce where blood from superior vena cava is diverted to the pulmonary artery. As the pulmonary artery bifurcation is preserved, the superior vena caval blood will flow to right and left pulmonary arteries. In the original Glenn shunt, the superior vena cava, and pulmonary arteries were divided and then end-to-end anastomosis done. The entire superior vena caval blood was diverted to the light pulmonary artery. Bidirectional Glenn (BDG) is a superior operation because the SVC blood flows into both pulmonary arteries.


Related Discussions:- Explain bidirectional superior vena cavo

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Define dehydration reaction between both molecules, Some organisms contain ...

Some organisms contain enzymes that condense a fatty alcohol and a fatty acid to generate wax esters. Draw decanol, plamitic acid (C16:0 fatty acid) and the resulting wax ester gen

Region of the injury in the axial skeleton, what major nerve do you think i...

what major nerve do you think is being compressed when a person often feel pain in the posterior surface of the thigh radiating to the area behind the knee and where is the likely

Periapical radiography - criteria for endosteal implants, Q. Periapical rad...

Q. Periapical radiography - criteria for endosteal implants? Periapical radiographs are images of a limited region of the mandibular or maxillary alveolus.  Periapical radiogra

State the definition of temperature, State the Definition of Temperature ...

State the Definition of Temperature Temperature may be defined as degree or amount of body heat.  It is the balance between heat produced and heat lost by the body.  It is meas

Polarity do water-soluble and fat-soluble substances, Q. Which type of pola...

Q. Which type of polarity do water-soluble and fat-soluble substances respectively have? Water-soluble substances are polar molecules that are they have electrically charged ar

Amoeboid tapetum - tapetum, Amoeboid Tapetum - Tapetum It is also know...

Amoeboid Tapetum - Tapetum It is also known as invasive or periplus modial tapetum. This type of tapetum is more prevalent in the monocotyledons (Arum) than in the dicotyledon

Explain adaptive radiation and convergence, Adaptive radiation OR convergen...

Adaptive radiation OR convergence Adaptive radiation Explanation of the adaptive radiation process linked to the introduction of a single species and the wide range

What is the name of the dna duplication process, What is the name of the DN...

What is the name of the DNA duplication process? What is the main enzyme that participates in it? The process of copying, or duplication, of the DNA molecule is called replica

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd