Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain Balanus
The realised niche of Balanus is the same as its fundamental niche
Lower limits: as for fundamental niche.
Upper limits: as for fundamental niche but no comparison with other species. BU Eg, Balanus has a low physiological tolerance to dehydration/ desiccation so can't survive higher up the shore.
COMMON RESPIRATORY DISORDERS: Respiration is one of the most vital functions of the body. The purpose of respiration is to provide oxygen ta the body cells and to remove exc
steps in genetic engineering
If you create an F2 generation by mating two of the F1 offspring from your cross of a pure-bred brown pig with a pure-bred heavy spotted red pig. Explain why the pigs in your F2 ge
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Define Biochemical and Metabolic Problems and their Management? Hypokalaemia (low concentration of potassium ion in the blood), we learnt earlier, is a problem caused due to se
Types of Oxygenators a) Film Oxygenators b) Disc Oxygenators c) Bubble Oxygenators d) Membrane Oxygenators. Film and Disc Oxygenators are not used for clinical
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
A new drug named ANTAG-CaSR has been developed that is an antagonist at calcium-binding sites of CaSRs (Calcium-Sensing Receptors) in the plasma membranes of parathyroid gland cell
Hom o sapiens sapiens (MODER N MAN) - Developed from Cro-Magnon about 10,000 years ago after last glacial period in the regions of Caspian and Mediterranean seas.
what is gaseous exchange
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd