Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain arterial continuous mummer?
Arterial Continuous Mummer : These originate in constricted arteries as in carotid or femoral artery obstruction (Mummer are louder in systole, often only systolic) or in non-constricted arteries as in patients with large systemic lo pulmonary arterial collaterals in TOF with pulmonary atresia. Mammary souffle is an innocent murmur heard during late pregnancy and puerperium. It is typically louder in systole.
Development of Pollen in Cyperaceae In all members of the Cyperaceae out of the four nuclei formed after meiosis, only one functions, the others degenerate. The functional nuc
ACCESSORY GLANDS - 1 . PROSTATE GLAND - One in number, 4-5 lobed, it forms 15-30% of semen.Citric acid, lipid, acid phosphatase spermin, fibrinolysine are present.
Q. Define Premotor Cortex Located in the frontal lobes? Premotor Cortex - Involved in control of more complex, learned motor skills like writing, driving, etc. Broca's area or
Q. Reduction in left ventricular? Vasodilators improve stroke volume, and reduce degree of regurgitation. This results from decrease in systemic vascular resistance and leads t
briefly desribe the eggs and follicles in rabbit
Q. What is the main risk factor for lung cancer? The major risk factor for lung cancer is tobacco smoking. In The large number of cases of this kind of cancer is due to the inc
Q. Which all are the living beings that carry out photosynthesis? Which is the cell organelle responsible for the absorption of light for the photosynthesis process in algae and pl
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Width of the Periimplant keratinized Mucosa Clinical and experimental studies have failed to support the concept of an "adequate width" of keratinized tissue adjacent to natura
Testicular Hypoplasia Hypoplasia refers to testicular disorders related to congenitally underdeveloped and underactive spermatic epithelium of one or both testes even though t
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd