Explain armamentarium, Biology

Assignment Help:

Armamentarium

1. Denture duplicator or a modified plastic soapdish. (A plastic large soapdish with a base and cover can be adapted by drilling 2 mm holes interspersed and covering the entire cover using a round acrylic trimmer).

2. Alginate mixing bowl and spatula.

3. Wax knife

4. BP Blade

 


Related Discussions:- Explain armamentarium

Calculate how much of the stock solution, A 15 mM solution of potassium chl...

A 15 mM solution of potassium chloride is needed for and experiment. The only liquid stock that is a available is a 1 M solution. Calculate how much of the stock solution is needed

Explain the stages in taxonomic procedures - beta taxonomy, Explain the sta...

Explain the stages in taxonomic procedures - Beta Taxonomy This stage is also known as macro taxonomy or synthesis taxonomy. At this level the species are arranged or classifie

Transplant procedure and immunosuppression, TRANSPLAN T PROCEDURE - Op...

TRANSPLAN T PROCEDURE - Operation is done under general anaesthesia, duration 3-4 hrs. Cut is given in the lower abdomen. Donar's kidney is transplanted retroposistonicaly

Explain the term rastelli operations, Explain the term Rastelli operations ...

Explain the term Rastelli operations ? This is the operation of choice for transposition with VSD and left ventricular outflow obstruction. The principle of this operation is:

A decrease in parasympathetic discharge to the heart, A decrease in parasym...

A decrease in parasympathetic discharge to the heart leads to A. a decrease in the conductance of F-channels in SA node cells. B. an increase in the conductance of potassium

Determine the function of monomeric enzymes, Determine the fuction of Monom...

Determine the fuction of Monomeric enzymes Monomeric enzymes include, pepsin, like the pancreatic serine proteases, plays a role in the digestion of proteins eaten by mammals.

What is the binding between two amino acids, Q. What is the binding between...

Q. What is the binding between two amino acids called? The chemical bond between two amino acids is called a peptide bond.

Define nutritional management of anorexia nervosa, Define Nutritional Manag...

Define Nutritional Management of Anorexia Nervosa? The overall goal of nutritional rehabilitation of anorexia nervosa patients is to restore weight, normalize eating pattern, a

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd