Explain acyclovir, Biology

Assignment Help:

Explain Acyclovir

Available in topical, oral, and intravenous (IV) formulations, acyclovir is used to treat herpes simplex virus (HSV) and varicella-zoster virus (VZV) infections. Acyclovir cream reduces the duration of herpes labialis by about half a day. Oral acyclovir is effective for both primary and recurrent genital HSV infections. Long-term oral sup pression with acyclovir decreases the frequency of symptomatic genital recurrences and asymptomatic viral shedding. Oral acyclovir begun within 24 hours after the onset of rash, decreases the severity of primary varicella infection and can also be used to treat localized zoster. IV acyclovir is the drug of choice for treatment of HSV infections that are visceral, disseminated or contain the central nervous system (CNS) and for serious or disseminated VZV infections.

 


Related Discussions:- Explain acyclovir

Secretion of parathormone and calcium blood level, Q. What is the relation ...

Q. What is the relation between secretion of parathormone and the calcium blood level? The parathormone increases the calcium blood level since it stimulates the resorption (re

Importance of meiosis, Meiosis becomes significant for the following reason...

Meiosis becomes significant for the following reasons. Constant Number of Chromosomes: It brings about a reduction in the chromosome number from a diploid (2n) condition to

Wind-environmental components, Wind Strong current of air is known as w...

Wind Strong current of air is known as wind, it is an important ecological factor as it affects plant life mainly on flat plains, along sea coasts and at high altitudes in moun

Oogenesis, New advancements and discoveries related to oogenesis

New advancements and discoveries related to oogenesis

Microorganisms on basis of oxygen requirement for growth, Q. Microorganisms...

Q. Microorganisms on basis of oxygen requirement for growth? On basis of oxygen requirement for growth: - Obligate Aerobes: Require oxygen for growth and multiplication e.g

Name mimicry by which insect mimics insec for protection, From the followin...

From the following, name the type of mimicry by which a palatable, acceptable insect mimics an unfavorable, noxious insec for protection. a) Batesian mimicry (pron: BATE-see-an

Insulation by fur and feathers, Normal 0 false false false ...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

The transport system in earthworm., The transport system in earthworm ...

The transport system in earthworm The scientific name of earthworm is megascolex. It consists of hearts, blood vessel and blood. There are 8 pairs of hearts in the earthw

Explain nephrotic syndrome, Explain Nephrotic syndrome Nephrotic syndr...

Explain Nephrotic syndrome Nephrotic syndrome :- Kidney disease due to degeneration of renal tubule.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd