Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain Acyclovir
Available in topical, oral, and intravenous (IV) formulations, acyclovir is used to treat herpes simplex virus (HSV) and varicella-zoster virus (VZV) infections. Acyclovir cream reduces the duration of herpes labialis by about half a day. Oral acyclovir is effective for both primary and recurrent genital HSV infections. Long-term oral sup pression with acyclovir decreases the frequency of symptomatic genital recurrences and asymptomatic viral shedding. Oral acyclovir begun within 24 hours after the onset of rash, decreases the severity of primary varicella infection and can also be used to treat localized zoster. IV acyclovir is the drug of choice for treatment of HSV infections that are visceral, disseminated or contain the central nervous system (CNS) and for serious or disseminated VZV infections.
What are the main cells of which poriferans are made? Sponges have their outer wall covered by flat cells known as pinacocytes and having pores well-delimited by special cells
Explain about the Picric acid test? This test is answered by all reducing sugars, with a free aldehyde or ketone groups. Monosaccharides possess a free aldehyde or ketone group
What is the Results of Congenital Pulmonary Stenosis? Early mortality for open pulmonary valvotomy in neonates varies between 6 and 10 per cent. For infants and children, surgi
Liverworts and mosses are characterized by their lack of vascular conducting tissue. These two groups of liverwort, plants and mosses, are known by which of the below terms: a)
Q. Show the types of oesophagitis conditions? The two types of oesophagitis conditions: 1. Acute Oesophagitis - It is characterized by substantial pain on swallowing. It is
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
While explaining the concept of natural selection, we have stressed the fact that natural selection is synonymous with differential or non-random reproduction. Natural selection ai
Patient Care The primary basic principle in nutritional practice to be valid must be person/patient- centered. It must be based on initial and continuing identified nee
Q. Optional use values of biodiversity? Optional values are associated with potential use in the future. Accordingly one opts to conserve biodiversity based on the hope that it
What is Cellular Respiration? Cellular Respiration : The most important of the metabolic processes, cellular respiration, provides energy for most chemical reactions in an or
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd