Explain about the term accommodation, Biology

Assignment Help:

Explain about the term accommodation.

Normally, the human eye focuses at objects at infinity, without exerting any power. This implies that while a person is observing an object at infinity, the eye is at rest and no effort is needed to focus on the object. If the object moves closer from infinity, till a distance of 6 meters from the eye, still no additional power or effort is required to be able to focus on the object. However when an object moves closer than 6 meters, the light rays entering the eye from the objects is more divergent. So as to bring these divergent light rays into focus over the retina the diopteric power of the eye must be increased. The mechanism by which the eye increases its diopteric power and hence the ability to focus at an object close to 154 the eye is called Accommodation.

1934_Ray of light focussed behind the retina.png

Ray of light focussed behind the retina (dotted line) before accommodation, and on the retina (solid line) with the help of accommodation


Related Discussions:- Explain about the term accommodation

Hybrid sterility, Hybrid sterility can be regarded as yet another form of i...

Hybrid sterility can be regarded as yet another form of interspecific sterility. The offspring of the interspecific crosses are mainly sterile. Geological studies have shown that t

Reflexes related to respiration, SOM E COMMON REFLEXES RELATED TO RESPIRAT...

SOM E COMMON REFLEXES RELATED TO RESPIRATION - 1.      Cough Reflex: Due to stimulation in Trachea before it 2.5 lit. air is inhaled. 2.      Sneezing Reflex: Stimulati

Explain differences between thrombus and embolus, Explain the differences b...

Explain the differences between a thrombus and an embolus. Include predisposing factors, mechanism of occurrence, treatment, and methods of detection with medical imaging, if any.

Lipoidal models, LIPOIDA L MODELS According to Overton (1902) plasm...

LIPOIDA L MODELS According to Overton (1902) plasma membrane consists of single layer of lipid, because cell permeability is related to lipids. According to Gorter and

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Absorption of proteins in infants, Absorption of proteins in infants In...

Absorption of proteins in infants In  infants, permeability of  the  intestine appears to be greater than  in  later  life, and some  large  protein molecules such as antibodie

What is the generic function of leukocytes, What is the generic function of...

What is the generic function of leukocytes? What are leukocytosis and leukopenia? The generic function of leukocytes is to contribute in the defense of the body against strange

26 The Human Impact on the Environment, What are the principal sources of e...

What are the principal sources of excessive nitrate and phosphate in rivers and lakes?

Explain about the obliques muscles, Explain about the Obliques muscles ...

Explain about the Obliques muscles The superior and inferior oblique muscles form an angle of about 51 0 with the optical axis. The oblique muscles produce cyclorotation becau

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd