Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain about the Simple Proteins?
Simple proteins are those that are made of amino acid units just joined by peptide bond. Upon hydrolysis they yield a mixture of amino acids and nothing else.
Examples: Albumins: serum albumin, Egg albumin, Lactalbumin
Globulin: Serum globulin, Tissue globulin.
Gliadins: Wheat gliadin, hordein (barley) etc.
Albuminoids: Keratin of hairs, Collagen of tendons, egg shell and bones, skin, elastin, ligaments and bones.
Histones: Globin of haemoglobin.
Protamine: Salmine, the spermatozoa of salmon fish.
Which of the following occur in response to an increase in the length of the right knee extensors in response to a quick tap applied to the right patellar tendon? An increase in t
Types of Community On the basis of size and degree of relative independence communities may be divided into two types: i) Major Community: These are large-sized, well org
Anti Platelet Drugs In the early years of CABG, patients used to be put on aspirin and persantin (Dipyridamole). Persantin is not routinely prescribed now. Aspirin dose can b
Does natural selection produce an effect directly on genes, on genotypes, or on phenotypes? Explain please.
Types of Gonads The gonads of vertebrates can be classified into the following two types Mammalian type and Non-mammalian type. They differ from
Draw decanol, plamitic acid (C16:0 fatty acid) and the resulting wax ester generated by a dehydration reaction between both molecules
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
defitionce of vitamin d
How Infections and Infestations cause PEM? Childhood infections (viral/bacterial) and parasitic infestations are almost always associated with PEM. These cause anorexia (loss o
α - amylase activity by GA 3 - Dormancy Of the enzymes required for the digestion of starch α-amylase appears immediately after the start of germination. It was found that
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd