Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain about the optic disc
The optic disc is also called a blind spot while the macula is referred to as the yellow spot. The ora serrata (the intersection between the retina and the pars plana) can be seen through indirect ophthalmoscopy. The red colour of the fundus is because of the transmission of light reflected from the posterior 136 sclera through the capillary bed of the choroid.
What is the Harshey-chase experiement .explain in detail
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Bovine ephemeral fever Ephemeral fever is commonly known as 'three-day sickness'. It affects mainly cattle and occasionally sheep in India. Causative agent is a mosquito-borne vir
Describe about Psycho-social Change in children? Adolescence is a period of maturation for both mind and body. Along with the physic4 growth, emotional and intellectual develop
how nerve signals are transmitted
PSYCHOSOCIA L PROBLEMS - 1 . Accidental injury - Automobile accidents are no. 1 killers of adolescents, as they drive often fast. 2 . Depression - I
Q. Causes of reduced Serum HDL levels? Possible causes of reduced Serum HDL levels: - Cigarette smoking - Hypertriglyceridemia - Obesity - Genetic factors - Lack
Q. What is Bigunnides? Bigunnides: They are atni diabetic drugs which do not affect the output of insulin. These are preferred to sulphony lureas because they do not cause we
What Is the advantage of having a coelomic body cavity
Q. Function of Dopamine in consciousness? An increase in dopamine activity produces an increase in wakefulness. Dopaminergic neurons in the ventral tegmental areas are constant
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd