Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain about the Maillard Reaction?
The Maillard reaction sometimes called nonenzymatic, nonoxidative browning is simply the reaction between the amino group of a protein or peptide or amino acid and the reducing group of a reducing sugar at high temperature. An amino group from a protein combines with an aldehyde or ketone group of a reducing sugar to produce brown colour and aroma in a variety of foods, including fried foods and baked goods such as breads. It is interesting that the type of sugar and the type of amino acids will impart the "brown" color thus obtained. The color may range from a yellow to red. The key here is the reducing sugar. Those that are efficient reducing sugars are fructose, glucose, maltose, galactose and lactose. Surprisingly, table sugar, or sucrose, is not a reducing sugar. The reactivity of glucose on heating gives to the subtle orange red colour in bread crust which is a result of browning (Maillard reaction). Caramelization of fructose generates a dark brown crust. Breads that consist of sucrose often yield a darker, rich-coloured crust than breads prepared with glucose.
Q. What are the main factors that affect the growth of a population? The major factors that make populations grow are births and immigration. The major factors that make popula
What are the environmental harms caused by mercury pollution? What are the main sources of mercury pollution? Mercury is a metal that when present in the water of lakes, river
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Define Energy Requirement for Cancer Patients? It must be clear to you that cancer imposes increased energy demands because of the hyper-metabolic state of the disease process
Define the term - magnetoencephalography A variant ERP known as magnetoencephalography (MEG) has been developed. MEG, which is still in its infancy, requires upward of 60 elect
What is the indolacetic acid (IAA)? IAA or Indolacetic acid (indolyl-3-acetic acid) is the major natural auxin made by plants. It promotes plant growth and cellular differentia
State the Diagnosis and prevention of VIBRIO PARAHAEMOLYTICUS Diagnosis: Diagnosis of gastroenteritis caused by this organism is made by culturing the organism from the diarrh
applications of diffusion
Write two functions of proteins in biological systems. The important functions of proteins in biological systems are as follows: enzymes membrane carriers anti
Corpus Cardiacum - Endocrine Organs We before mentioned that corpus cardiacum (pl. corpora cardiaca) is a neurohemal organ in insects. It is gland of neural origin. They are c
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd