Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain about the Lipoproteins?
These are the Multicomponent complexes of lipids and proteins that form distinct molecular aggregates. They contain polar and neutral lipids, cholesterol or cholesterol esters in addition to protein. The proteins and lipids are held together by non covalent bonds. Lipids are primarily hydrophobic and cannot be easily transported through all aqueous environments as blood. The lipoprotein combination renders the lipid molecule hydrophilic and is transported in the blood to tissues which can use or store the lipids.
Insulin was the first protein to be sequenced biochemically. Assuming that there were no introns involved in the process, what are the possible DNA sequences that produced the last
The term farm animal genetic resources (AnGR) is used to include all animal species, breeds and strains (and their wild relatives) that are of economic, scientific and cultural int
Determine the term - essential element It becomes difficult to meet all the conditions so as to establish essentiality. This is particularly so for the elements that are requir
#questionwhy is urea the major nitrogenous excretory product..
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
An alternative approach has been to identify areas with the highest number of endemics or species with a restricted geographical range. Assessments of this nature have been very of
Explain TechnologicaI advances of clinical dietitian TechnologicaI advances in nutritional support for the critically ill have enhanced the clinical dietitian's role. In the
Explain the relationship between an agonist muscle and its antagonist as it relates to positional control, functional movement and neuromuscular activation. For example, how the tw
Mesophytes These plants grow in moist habitats and well-aerated soils. They prefer soil and air of moderate humidity but fail to swive in areas with water-logged soils or oveta
Describe tranposition of great arteries with intact ventricular septum? Transposition of great arteries with intact ventricular septum (or small VSD): There is usually inadequa
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd