Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain about the Foods Effect on Drug Utilization?
The following illustrations highlight the effect of food on drug utilization.
Liver and green leafy vegetables can decrease the effect of anticoagulants (blood- thinning drugs). These foods contain vitamin K, which helps promote blood clotting. On the other hand, aspirin and aspirin-containing compounds can enhance the effect of the blood-thinning drug and promote excessive bleeding.
One of the most hazardous food and drug interactions is between monoamine oxidase (MAO) inhibitors and aged or fermented foods. MA0 inhibitors are used to treat depression and high blood pressure. They decrease the metabolism in the body of compounds called monoamines. MA0 inhibitors can react with a substance called tyramine (a monoamine) in foods such as aged cheese, fava beans and others. As a result blood pressure can rise to dangerous levels causing severe headaches, brain hdemorrhage and, in extreme cases, death. Natural licorice contains a substance which can increase blood pressure when eaten hi large amounts. Long-term use of licorice and licorice-flavoured candy or drugs can counteract the effect of medication used for treating high blood pressure.
ONSE T OF PUBERTY IN FEMALE - Attains at the age of 13 by estrogen hormone. It includes - 1. Growt h of breasts 2. Growth
Cell Theory The term cell was first used by an English cytologist, Robert Hooke (1665) not for unit protoplasmic masses, but for the well defined and empty compartments, he obs
Explain about Posterior wall Posterior wall separates the antrum from the infra-temporal fossa and contains two important structures. Posterior superior alveolar nerve and
the concept that new varieties of organisms are still evolving is best supported by the.......?
Explain Crossing Over in genetics? Crossing over is when the arms of homologous chromosomes exchange segments (and therefore genes) with each other. Recall that one of the homo
The aqueous solution with the lowest pH is: Select one: a. 0.01 M HCl. b. 0.1 M acetic acid (pKa = 4.86). c. 0.1 M formic acid (pKa = 3.75). d. 0.1 M HCl. e. 10 t
What are vitamins? What are the main vitamins needed by humans? Most vitamins are coenzymes (fundamental substances for the enzyme functioning) that are not formed by the organ
Describe the methods that are used for the isolation and identification of bacteria.(20 marks)
physiology of skin
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd