Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain about the Dessicator?
A dessicator is used to prevent an item from absorbing moisture. It is able to accomplish this because of a chemical, known as the dessicant, is housed within the container.
This chemical, normally sodium sulfate, is extremely hygroscopic and will readily absorb water from the air. Figure illustrates a dessicator used to keep salts that absorb atmospheric humidity. It prevents chemicals from absorbing moisture from air.
PROJECTS THAT HAVE TO BE DONE IN SCHOOL ABOT PICICULTURE
Explain the Most Probable Number (MPN)? MPN is a statistical estimating technique which is based on the fact that more the number of bacteria in a sample, more is the dilution
significance of amoebozoa
Explain Food lipids It is either consumed in the form of "visible" fats, which have been separated from the original plant or animal sources, such as vegetable oil and butter,
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Assume for this question that we are discussing a rare human disorder. Describe as detailed as possible the characteristics of this disorder if it is: autosomal dominant autosomal
Problem of Polarity in Regeneration in Planarians As in Hydra, flatworm regeneration as well appears to occur in a polar fashion. There seems to be ananterior-posterior gradie
What is Computerised tomography Computerised tomography (CT, but also known as computerised axial tomography, or CAT) provides structural images. To generate brain scans, low l
what process are nematocysts formed by the cnidoblast?
Define about the Hyponatremia and Hypernatremia? Serum concentration of sodium is normally regulated within the range of 135 to 145 milimole per litre (a). Hyponatremia is defi
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd