Explain about phylum annelida, Biology

Assignment Help:

How is the respiratory system of beings of the phylum Annelida characterized?

Respiration in annelids can be cutaneous or branchial. Cutaneous respiration happens due to the rich vascularity under the epidermis. The gills, present in aquatic annelids, are located in the parapodia (false claws) that have an extensive capillary net.

 


Related Discussions:- Explain about phylum annelida

Deficiency diseases-evaluation of production diseases, Evaluation of produc...

Evaluation of production diseases Generally, production diseases are acute states and respond dramatically to administration of a deficient nutrient or metabolite. The nutriti

Thermal properties-specific heat-water properties, Thermal Properties ...

Thermal Properties The range of temperature variatidn in the aquatic environment is smaller in comparison to air. This means the rate of change of temperature is slower in the

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Single vessel disease, Single Vessel Disease (SVD) :  They do well on medi...

Single Vessel Disease (SVD) :  They do well on medical treatment or with angioplasty. However if proximal LAD is significantly blocked and LIMA can be used as a conduit, surgery g

Discuss the concept of alpha-islet cells of the pancreas, Glycogen A. p...

Glycogen A. production in the liver increases in response to an increase in blood plasma levels of glucagon. B. is secreted by alpha-islet cells of the pancreas. C. bindi

Define ailing and failing, Define ailing and failing Clinically unhealt...

Define ailing and failing Clinically unhealthy implants are classified as "ailing" or "failing". It is necessary to distinguish between an ailing versus a failing implant to de

How the rhizopus reproduce?, How the Rhizopus reproduce? Rhizopus usual...

How the Rhizopus reproduce? Rhizopus usually reproduce asexually, but under unfavourable conditions, sexual reproduction (isogamous) occur resulting in formation of zygospores

Calculate the volume of a 25% urethane, Assume that the blood volume of a r...

Assume that the blood volume of a rabbit is 0.5 liters. If the effective dose of the anesthetic urethane is 10 µgrams/ml of blood, calculate the volume of a 25% urethane solution t

How can a child become infected with gonorrhoea, How can a baby become infe...

How can a baby become infected with (a) gonorrhoea, (b) syphilis   (a)  During birth, a baby might be become infected with gonorrhoea bacteria as it passes by t

Define briefly about the nutrition security, Define Briefly about the Nutri...

Define Briefly about the Nutrition security? Nutrition security can be briefly defined as a balance between biological requirements in energy and nutrients and the quantity and

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd