Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
How is the respiratory system of beings of the phylum Annelida characterized?
Respiration in annelids can be cutaneous or branchial. Cutaneous respiration happens due to the rich vascularity under the epidermis. The gills, present in aquatic annelids, are located in the parapodia (false claws) that have an extensive capillary net.
Evaluation of production diseases Generally, production diseases are acute states and respond dramatically to administration of a deficient nutrient or metabolite. The nutriti
Thermal Properties The range of temperature variatidn in the aquatic environment is smaller in comparison to air. This means the rate of change of temperature is slower in the
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Single Vessel Disease (SVD) : They do well on medical treatment or with angioplasty. However if proximal LAD is significantly blocked and LIMA can be used as a conduit, surgery g
Glycogen A. production in the liver increases in response to an increase in blood plasma levels of glucagon. B. is secreted by alpha-islet cells of the pancreas. C. bindi
Define ailing and failing Clinically unhealthy implants are classified as "ailing" or "failing". It is necessary to distinguish between an ailing versus a failing implant to de
How the Rhizopus reproduce? Rhizopus usually reproduce asexually, but under unfavourable conditions, sexual reproduction (isogamous) occur resulting in formation of zygospores
Assume that the blood volume of a rabbit is 0.5 liters. If the effective dose of the anesthetic urethane is 10 µgrams/ml of blood, calculate the volume of a 25% urethane solution t
How can a baby become infected with (a) gonorrhoea, (b) syphilis (a) During birth, a baby might be become infected with gonorrhoea bacteria as it passes by t
Define Briefly about the Nutrition security? Nutrition security can be briefly defined as a balance between biological requirements in energy and nutrients and the quantity and
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd