Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. Explain about Metabolic diseases?
Metabolic diseases, as you already know, refer to those disorders in which the various reactions in the cells are effected (production of energy or utilization of energy) due to abnormal production of one or more hormones, cop. a deficiency of an enzyme. Most metabolic disorders are genetic, though a few are "acquired" as a result of diet, toxins, infections, etc. Metabolic disorders or inborn errors of metabolism are inherited traits that result in the absence or reduced activity of a specific enzyme or cofactor.In general, these genetic metabolic disorders are caused by genetic defects that result in missing OF improperly constructed enzymes necessary for some step in the metabolic process of the cell. Phenylketonuria, tyrosinernia, maple syrup urine disease, homocystinuria and galactosemia are some common metabolic diseases caused by genetic defects.
Gout is yet another metabolic disease caused due to a disturbance of uric acid metabolism occurring chiefly in males, characterized by painful inflammation of the joints, especially of the feet and hands, and arthritic attacks resulting from elevated levels of uric acid in the blood and the deposition of rate crystals around the joints. The condition can become chronic and result in deformity.
explain excretory system of prawn?
Fever influenza
The Protein targeting or protein sorting is the mechanism by that a cell transports proteins to the appropriate positions in the cell or outside of it. A Sorting targets can be the
Why are the plants having single-seeded fruits and plants having fruits with surplus one seed? The Plants that produce single-seeded fruits, for instance, avocado and mango oft
Hypothalamus and Pituitary The most obvious neuroendocrine link is between the hypothalamus and pituitary. The hypothalamus is a part of the brain which is connected to the pi
Acute Myocardial Infarction : Patients with acute non-Q myocardial infarction may need urgent intervention as indicated for cases of unstable angina.
DNA
Heat Loss Temperature regulation is extremely uneconomical if it depends only on variations in metabolism. Therefore, mechanisms for losing excess heat have been developed by
What is the difference between the endocrine gland and the exocrine gland? Endocrine gland is a gland whose secretions (known as hormones) are collected by the blood and reach
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd