Explain about metabolic diseases, Biology

Assignment Help:

Q. Explain about Metabolic diseases?

Metabolic diseases, as you already know, refer to those disorders in which the various reactions in the cells are effected (production of energy or utilization of energy) due to abnormal production of one or more hormones, cop. a deficiency of an enzyme. Most metabolic disorders are genetic, though a few are "acquired" as a result of diet, toxins, infections, etc. Metabolic disorders or inborn errors of metabolism are inherited traits that result in the absence or reduced activity of a specific enzyme or cofactor.In general, these genetic metabolic disorders are caused by genetic defects that result in missing OF improperly constructed enzymes necessary for some step in the metabolic process of the cell. Phenylketonuria, tyrosinernia, maple syrup urine disease, homocystinuria and galactosemia are some common metabolic diseases caused by genetic defects.

Gout is yet another metabolic disease caused due to a disturbance of uric acid metabolism occurring chiefly in males, characterized by painful inflammation of the joints, especially of the feet and hands, and arthritic attacks resulting from elevated levels of uric acid in the blood and the deposition of rate crystals around the joints. The condition can become chronic and result in deformity.


Related Discussions:- Explain about metabolic diseases

Prawn, explain excretory system of prawn?

explain excretory system of prawn?

Fever, Fever influenza

Fever influenza

What is protein targeting, The Protein targeting or protein sorting is the ...

The Protein targeting or protein sorting is the mechanism by that a cell transports proteins to the appropriate positions in the cell or outside of it. A Sorting targets can be the

Why are the plants having single-seeded fruits, Why are the plants having s...

Why are the plants having single-seeded fruits and plants having fruits with surplus one seed? The Plants that produce single-seeded fruits, for instance, avocado and mango oft

Hypothalamus and pituitary, Hypothalamus and Pituitary The most obviou...

Hypothalamus and Pituitary The most obvious neuroendocrine link is between the hypothalamus and pituitary. The hypothalamus is a part of the brain which is connected to the pi

Acute myocardial infarction, Acute Myocardial Infarction :  Patients with ...

Acute Myocardial Infarction :  Patients with acute non-Q myocardial infarction may need urgent intervention as indicated for cases of unstable angina.

Heat loss, Heat Loss Temperature regulation is extremely uneconomical...

Heat Loss Temperature regulation is extremely uneconomical if it depends only on variations in metabolism. Therefore, mechanisms for losing excess heat have been developed by

Explain the endocrine gland and the exocrine gland, What is the difference ...

What is the difference between the endocrine gland and the exocrine gland? Endocrine gland is a gland whose secretions (known as hormones) are collected by the blood and reach

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd