Explain about hypoglycemia, Biology

Assignment Help:

Q. Explain about Hypoglycemia?

It is a Greek term: hypo -meaning less; glyc- means sweet; and emia- means "of the blood". It is a condition in which less than normal amount of sugar (glucose) circulates in the blood. Less than 70mg/100ml is considered as low blood sugar. It is associated with warning signs like increased heart rate, excessive sweating, confusion, etc. It may vary from person to person.


Related Discussions:- Explain about hypoglycemia

Explain nutritional science, Explain nutritional science Dietitians ar...

Explain nutritional science Dietitians are in a 'helping' profession because the services they provide are beneficial to individuals  and society and dedicated to improving th

Spinal cord, Spinal cord Spinal cord is a long and cylindrical struc...

Spinal cord Spinal cord is a long and cylindrical structure. It passes through the vertebral column extending all along the dorsal surface of trunk. Vertebrae of the v

Explain why goblet cells are non-functional, If for some reason our goblet ...

If for some reason our goblet cells are non-functional, this will adversely affect: 1. Production of somatostatin 2. Secretion of sebum from the sebaceous glands 3. Matura

Examples of the energetic function of organic molecules, Q. What are the fe...

Q. What are the few examples of the energetic function of organic molecules? Since they are complex molecules, organic molecules store large amount of energy, presenting many c

Gametogenesis - human development, Gametogenesis - Human Development G...

Gametogenesis - Human Development Gametogenesis as you are responsive is the process of formation and development of specialized reproductive cells, ova in females and sperms

The cell, how does autophagy help in converting a tadpole larva into an adu...

how does autophagy help in converting a tadpole larva into an adult amphibian

Explain theory of gram staining of bacterial cultures, Explain Theory or Pr...

Explain Theory or Principle of Gram Staining of Bacterial Cultures? Foods are rich in various nutrients and can support the growth and survival of microorganisms. The microbial

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain the evolution of the vascular plant body, Explain the Evolution of ...

Explain the Evolution of the Vascular Plant Body? Vascular Plant anatomy reflects adaptation to life on land. In an aquatic environment, the photosynthetic surfaces are support

How can coacervates be formed of phospholipids, How can coacervates be form...

How can coacervates be formed of phospholipids or polypeptides? Phospholipids are amphipathic molecules, i.e., they present a polar portion and a nonpolar portion. In contact w

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd