Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Homo neanderthalensis successfully lived in the cold, harsh ice-age conditions of Europe until becoming extinct approximately 30 000 years ago. Adaptations which enabled them to survive for up to 400 000 years included:
• short and stocky bodies• large noses• cave dwelling • living in groups of 8 - 25 individuals, with females moving between different groups• each group was territorial with territories covering about 50 km2• hunting large herbivores• surviving on a diet of up to 90% meat, as shown by bone and faecal analysis• cutting up meat using stone tools, which were slightly different for each group.
The genome of H. neanderthalensis has been sequenced using nuclear DNA extracted from bones. This has allowed comparisons with the genome of modern H. sapiens. From the data it is believed that the two species shared a common ancestor, most likely H. heidelbergensis, 270 000 - 440 000 years ago. There are DNA sequences in H. sapiens that are known to vary between individuals by only a single base. Researchers analysed these DNA sequences from H. sapiens populations in Western Europe, Southern Africa, West Africa, China and Papua New Guinea and compared them with H. neanderthalensis. It was found that H. neanderthalensis and non-African H. sapiens populations had 4% of their DNA in common. These DNA sequences are unique to them, and not found in the H. sapiens from the African populations.
Mention the role o ribosome's in peptide -bond formation .How does ATP facilitate it? a) Of springs derived by asexual reproduction are known as clones. Justify giving two R
E. coli DNA has a MW of about 2.7 x 10^9 Daltons. How many meters long is this molecule and what does this tell you about the state of the intracellular DNA? ( The lenght of a sing
How we write assimgment about mycobiology of mycoplasma in detail
What is Posterior Aneurysm? The technique of Posterior Aneurysm operation is the same. Care must be taken to avoid injury to the posterior papillary muscle and poster
Define the term Ancestral characteristic A character shared by all members of a taxonomic group of organisms (taxon) and used to define the unique nature of the group. The cha
distinguish between striated and cardic muscles
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q What are the constituent elements of the blood? The blood is made of a liquid and a cellular part the fluid part is called as plasma and in it there are several substances li
High blood pressure makes your heart work harder and, over time, can damage blood vessels throughout your body. If the blood vessels in your kidneys are damaged, they may stop remo
Define the effect of Dietary fibre on Satiety? Satiety: Several investigators have speculated that ingestion of a high fibre food induces a feeling of satiety, reduces meal siz
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd