Explain about homo neanderthalensis, Biology

Assignment Help:

Homo neanderthalensis successfully lived in the cold, harsh ice-age conditions of Europe until becoming extinct approximately 30 000 years ago. Adaptations which enabled them to survive for up to 400 000 years included:

• short and stocky bodies
• large noses
• cave dwelling
• living in groups of 8 - 25 individuals, with females moving between different groups
• each group was territorial with territories covering about 50 km2
• hunting large herbivores
• surviving on a diet of up to 90% meat, as shown by bone and faecal analysis
• cutting up meat using stone tools, which were slightly different for each group.

The genome of H. neanderthalensis has been sequenced using nuclear DNA extracted from bones. This has allowed comparisons with the genome of modern H. sapiens. From the data it is believed that the two species shared a common ancestor, most likely H. heidelbergensis, 270 000 - 440 000 years ago. There are DNA sequences in H. sapiens that are known to vary between individuals by only a single base. Researchers analysed these DNA sequences from H. sapiens populations in Western Europe, Southern Africa, West Africa, China and Papua New Guinea and compared them with H. neanderthalensis. It was found that H. neanderthalensis and non-African H. sapiens populations had 4% of their DNA in common. These DNA sequences are unique to them, and not found in the H. sapiens from the African populations.


Related Discussions:- Explain about homo neanderthalensis

Mention the role o ribosome in peptide, Mention the role o ribosome's in pe...

Mention the role o ribosome's in peptide -bond formation .How does ATP facilitate it? a) Of springs derived by asexual reproduction are known as clones. Justify giving two R

How many meters long is the molecule, E. coli DNA has a MW of about 2.7 x 1...

E. coli DNA has a MW of about 2.7 x 10^9 Daltons. How many meters long is this molecule and what does this tell you about the state of the intracellular DNA? ( The lenght of a sing

Mycroboilogy mycoplasma, How we write assimgment about mycobiology of mycop...

How we write assimgment about mycobiology of mycoplasma in detail

What is posterior aneurysm? , What is  Posterior Aneurysm? The te...

What is  Posterior Aneurysm? The technique of Posterior Aneurysm operation is the same. Care must be taken to avoid injury to the posterior papillary muscle and poster

Define the term ancestral characteristic, Define the term Ancestral charact...

Define the term Ancestral characteristic A character shared by all members of a taxonomic group of organisms (taxon) and used to define the unique nature of the group. The cha

Distinguish, distinguish between striated and cardic muscles

distinguish between striated and cardic muscles

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What are the constituent elements of the blood, Q What are the constituent ...

Q What are the constituent elements of the blood? The blood is made of a liquid and a cellular part the fluid part is called as plasma and in it there are several substances li

Target organ damage and complications, High blood pressure makes your heart...

High blood pressure makes your heart work harder and, over time, can damage blood vessels throughout your body. If the blood vessels in your kidneys are damaged, they may stop remo

Define the effect of dietary fibre on satiety, Define the effect of Dietary...

Define the effect of Dietary fibre on Satiety? Satiety: Several investigators have speculated that ingestion of a high fibre food induces a feeling of satiety, reduces meal siz

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd