Explain about coping mechanism, Biology

Assignment Help:

Q. Explain about Coping mechanism?

Coping mechanism is defined as the skill used to reduce stress. In other words, these are consciously used skills.

Overuse of coping mechanisms (such as avoiding problems or working obsessively) and defense mechanisms (such as denial and projection) may increase one's problem rather than solving it.


Related Discussions:- Explain about coping mechanism

Extensive factor of luria nebraska procedure, Extensive factor of Luria Neb...

Extensive factor of Luria Nebraska procedure Extensive factor analytic studies have been accomplished, and the factor structure of each of the major scales has been recognized.

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What is hemolytic disease of newborn, Questiion 1 List various methods ...

Questiion 1 List various methods used for hemoglobin estimation of donor. Add a note on specific gravity method Question 2 Why is it important to follow safety measures

What is spermatogenesis in human biology, What is Spermatogenesis in human ...

What is Spermatogenesis in human biology? The male sex cells, or sperm, are produced in the oval-shaped testes, the primary sex organs of the male reproductive system, in a pro

Carbohydrate is an organic compound , The Carbohydrate sets are covalently ...

The Carbohydrate sets are covalently attached to various variant proteins to form glycoproteins. Carbohydrates are a shorter percentage of the weight of glycoproteins than of prote

Per -capita rate, In one year, a population size of 500 changed to 496. Wha...

In one year, a population size of 500 changed to 496. What is the per-capita rate of increase/decrease?

Define requirements for underwater weighing method, Define Requirements for...

Define Requirements for underwater weighing method? • The equipment required to perform hydrostatic measurements is bulky and maintenance intense. • A large tank of water, usu

Respiratory lining of human lung, Normal 0 false false fals...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Different types of ecosystem, An ecosystem is a self sufficient interacting...

An ecosystem is a self sufficient interacting system in the biosphere. Eg. forest, desert, pond etc. almost, all the ecosystem have more or less similar fundamental plan for their

Explain the kingdom fungi organisms, Explain the Kingdom Fungi organisms? ...

Explain the Kingdom Fungi organisms? Kingdom Fungi consists of mostly eukaryotic, multicellular, non-photosynthetic organisms that derive their nutrients by absorption. Fungi

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd