Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. Explain about Coping mechanism?
Coping mechanism is defined as the skill used to reduce stress. In other words, these are consciously used skills.
Overuse of coping mechanisms (such as avoiding problems or working obsessively) and defense mechanisms (such as denial and projection) may increase one's problem rather than solving it.
Extensive factor of Luria Nebraska procedure Extensive factor analytic studies have been accomplished, and the factor structure of each of the major scales has been recognized.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Questiion 1 List various methods used for hemoglobin estimation of donor. Add a note on specific gravity method Question 2 Why is it important to follow safety measures
What is Spermatogenesis in human biology? The male sex cells, or sperm, are produced in the oval-shaped testes, the primary sex organs of the male reproductive system, in a pro
The Carbohydrate sets are covalently attached to various variant proteins to form glycoproteins. Carbohydrates are a shorter percentage of the weight of glycoproteins than of prote
In one year, a population size of 500 changed to 496. What is the per-capita rate of increase/decrease?
Define Requirements for underwater weighing method? • The equipment required to perform hydrostatic measurements is bulky and maintenance intense. • A large tank of water, usu
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
An ecosystem is a self sufficient interacting system in the biosphere. Eg. forest, desert, pond etc. almost, all the ecosystem have more or less similar fundamental plan for their
Explain the Kingdom Fungi organisms? Kingdom Fungi consists of mostly eukaryotic, multicellular, non-photosynthetic organisms that derive their nutrients by absorption. Fungi
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd