Explain about celiac disease, Biology

Assignment Help:

Q. Explain about Celiac Disease?

Gluten-sensitive enteropathy or, as it is more commonly called, celiac disease, is an autoimmune inflammatory disease of the small intestine. It is precipitated by the ingestion of gluten, a component of wheat protein-gliadin, in genetically susceptible persons. A defect in the enzyme system that. Splits this protein fraction along with atrophy of jejunal mucosa may be the specific cause for celiac disease. It usually develops within the first three years of life.

Child with celiac disease fails to thrive, losses appetite and has a potbelly. Stools are large, pale and offensive due to the presence of fat in the form of fatty acids. Anaemia is present with symptoms of paleness, fatigue, tachycardia (fast pulse). The microscopic section of the villi shows flattening of the villi. When gluten-free foods are given there is a dramatic recovery in the symptoms and the reversal of villi to normal growth. Celiac disease has also been noted to be associated with numerous neurologic disorders, including epilepsy, cerebral calcifications, and peripheral neuropathy.


Related Discussions:- Explain about celiac disease

Nonsurgical retreatment -secondary endodontic ttt, Nonsurgical retreatment ...

Nonsurgical retreatment (secondary endodontic ttt ) -Is the main difference between primary endodontic disease versus post treatment disease is the need to Regain access to

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What does radial symmetry mean, What does radial symmetry mean? What is the...

What does radial symmetry mean? What is the type of symmetry found in chordates? Which are other phyla of the animal kingdom that present species with radial symmetry? Radial

ZOOLOGY, POLYMORPHISM IN COLENTRATAtion..

POLYMORPHISM IN COLENTRATAtion..

What are the possible sources of human embryonic stem cells, What are the p...

What are the possible sources of human embryonic stem cells? Embryonic stem cells can be derived from individual cells of an early embryo, from blood cells in the umbilical co

Investigating, What is scientific investigation?

What is scientific investigation?

Haemodynamic study of constrictive pericarditis, Q. Haemodynamic Study of c...

Q. Haemodynamic Study of constrictive pericarditis? Simultaneous right and left heart studies are useful. Due to exaggerated waves in atria, W-shaped atrial pressure tracing wi

What is pollination, What is pollination? What are the main forms of pollin...

What is pollination? What are the main forms of pollination? The process in which pollen grains (the male gametophytes of phanerogamic plants) reach the female gametophyte is k

How does fecundation occur in angiosperms, After the pollination how does f...

After the pollination how does fecundation occur in angiosperms? In these plants is fecundation dependent on water? After the pollination one of the sperm nuclei from the polle

What is ancient gondwanaland, What is Ancient Gondwanaland? Did you kno...

What is Ancient Gondwanaland? Did you know that the land surface of the earth was once comprised of two super continents called Gondwana and Laurasia? Click on the Multimedia b

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd