Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain about Bioactive materials
Bioactive materials: Certain glasses, ceramics, and glass-ceramics that contain oxides of silicon, sodium, calcium and phosphorus (SiO2 , Na2O, CaO, and P2O5 ) form a chemical bond with bone, resulting in a strong mechanical implant bone bond. These materials do bond to bone through a time-dependent, kinetic modification of the surface triggered by their implantation within living bone. An ion-exchange reaction between the bioactive implant and surrounding body fluids results in the formation of a biologically active calcium phosphate layer on the implant. This layer is chemically and crystallographically equivalent to the mineral phase in bone which is responsible for the strong interfacial bonding.
Explain the Malthus' Theory about population growth? Darwin's Theory was also based on Thomas Malthus' writings on population growth, in which he explained that populations gro
Synthesis of fatty acids requires the movement of citrate out of the mitochondria. This occurs under conditions of high levels of acetyl CoA which is needed to stimulate the activi
What are the typical vegetation and the typical fauna of the tropical forests? In the vegetation of a tropical forest broadleaf evergreen trees predominate. On the top of the t
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Signify Asexual and how it is formed? Organisms which do not reproduce by recombination of genetic material contained in gametes. There is not any combination of a haploid sper
Problem of Polarity in Regeneration in Planarians As in Hydra, flatworm regeneration as well appears to occur in a polar fashion. There seems to be ananterior-posterior gradie
THYROI D DISORDERS - (A ) Hyperthyroidism (Hypersecretion of thyroid hormone). Graves' disease or Basedow's disease or Parry's disease or exophthalmic goitre . It is a
Q. What is an example of intraspecific competition? The Intraspecific competition occurs in practically all species, for instance, the competition of humans for a job.
Determine the Signs and Symptoms of Bulimia? 1. Binges, minimum twice a week for three months 2. Purging a Menstrual irregularities 3. Swollen glands Frequent fluct
Explain about the increases or decreases or shifts in demand terminology. Market into equilibrium P 1 Q 1 , here demand D 1 equals supply S 1 • When price reduce fromP 1
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd