Explain a renewable exhaustible natural resource, Biology

Assignment Help:

A renewable exhaustible natural resource is:

1. Coal

2. Petroleum

3. Minerals

4. Forest

Forest is a renewable exhaustible natural resource

 


Related Discussions:- Explain a renewable exhaustible natural resource

Parthenocarpy, Parthenocarpy It is generally observed that the fruit d...

Parthenocarpy It is generally observed that the fruit develops after fertilization and it has fertile seeds inside it. However, this is not always so. Fruits of certain variet

What are some examples of organs and tissues, What are some examples of org...

What are some examples of organs and tissues where mitosis is more frequent, less frequent or practically absent? Generally in vertebrates mitosis is more frequent in a tissue

Nurse case management , Organizational assessments are vital to the introdu...

Organizational assessments are vital to the introduction of Nurse Case Management (NCM) and Clinical Nurse Leaders (CNL)  ( I am in school for the CNL) Use the guidelines below

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

West nile virus infection, West Nile virus infection West Nile virus (W...

West Nile virus infection West Nile virus (WNV) is a type strain of flaviviruses and is related to Japanese encephalitis group. The virus was first isolated from a woman in the

Prawn, green gland in prawn

green gland in prawn

Show examples of cnidarians, Q. What are few examples of cnidarians? In whi...

Q. What are few examples of cnidarians? In which environments can these animals be found? Hydra, Jellyfish, sea anemones and corals are good examples. All of them are aquatic,

Encystment – protozoan, Encystment – Protozoan Encystment is character...

Encystment – Protozoan Encystment is characteristic of the life cycle of many protozoan. The protozoan secretes a thickened envelope (cyst) around itself and becomes inactive

Define key concepts and facts of polysaccharides, Define Key Concepts and F...

Define Key Concepts and Facts of Polysaccharides? 1. All polysaccharides contain several monosaccharide units. 2. All monosaccharide units are joined to each other by glycosidi

Explain about pre - diabetes, Q. Explain about Pre - Diabetes? Pre - Di...

Q. Explain about Pre - Diabetes? Pre - Diabetes is a condition where blood sugar level is above normal but below to be diagnosed as diabetes mellitus. It has been found that

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd