Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
URINARY BLADDER -
Pear shaped sac like. Situated in pelvic region of abdominal cavity. Ventrally placed.
Lined by transitional epithelum. Detrusor muscle i.e. to expell out present.
Outer covering is serous membrane.
Urinnary bladder when convert into urethra at that point sphinctor present made up of striped muscles i.e. Trigon.
Emptification of urinnary bladder is micturition. For micturition 300-400 ml. urine is needed.
Diaphragm is helpful in micturition.2 reflexes occur in bladder storage reflexes are vioding reflex and release reflex.
Bladder can store 700-800 ml. urine. Bladder is absent in snakes, crocodile, birds and prototheria.
In struthio present exceptionaly.
URETHRA
It starts from lower part of bladder. Open in male thorugh urinogenital aperture on glanse of penis.
In female on vulva by urethral opening.
Q. Treatment and Management of Hypertension? The first choice of treatment and management of primary hypertension is through behaviour modifications pertaining to food choices
Explain Non-Glycerides in Edible Oils? You may be aware of the fact that the glyceride fraction (an ester of glycerol and fatty acids that occurs naturally as fats and fatty oi
Species could be divided into which categories?
How can the knowledge about fermentation explain the origin of muscle cramps and pains after intense physical exertion? A typical fermentation process because of oxygen scarcit
What is oxygen-haemoglobin dissociation curve? Explain the role of red blood cells in the transport of oxygen and carbon dioxide by blood. Briefly describe the principle, pr
Q. Investigation of Tricuspid regurgitation by Echo Doppler? Investigations ECG in secondary TR shows evidence of right atrial overload and right ventricular hypertrophy
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What are the five human digestive secretions? Which of them is the only one that does not contain digestive enzymes? The human digestive secretions such as: saliva, gastric jui
How would Mendel's observations and conclusions have been dissimilar if many of the characteristics he studied, such as seed color and seed texture, had been controlled by genes lo
How many cellular nuclei does the pollen tube of angiosperms have? What is the ploidy of each of these nuclei? The pollen tube that is the mature male gametophyte of angiosperm
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd