Excretory system - urinary bladder, Biology

Assignment Help:

URINARY BLADDER -

Pear shaped sac like. Situated in pelvic region of abdominal cavity. Ventrally placed.

Lined by transitional epithelum. Detrusor muscle i.e. to expell out present.

Outer covering is serous membrane.

Urinnary bladder when convert into urethra at that point sphinctor present made up of striped muscles i.e. Trigon.

Emptification of urinnary bladder is micturition. For micturition 300-400 ml. urine is needed.

Diaphragm is helpful in micturition.2 reflexes occur in bladder storage reflexes are vioding reflex and release reflex.

Bladder can store 700-800 ml. urine. Bladder is absent in snakes, crocodile, birds and prototheria.

In struthio present exceptionaly.

URETHRA

It starts from lower part of bladder. Open in male thorugh urinogenital aperture on glanse of penis.

In female on vulva by urethral opening.


Related Discussions:- Excretory system - urinary bladder

Treatment and management of hypertension, Q. Treatment and Management of Hy...

Q. Treatment and Management of Hypertension? The first choice of treatment and management of primary hypertension is through behaviour modifications pertaining to food choices

Explain non-glycerides in edible oils, Explain Non-Glycerides in Edible Oil...

Explain Non-Glycerides in Edible Oils? You may be aware of the fact that the glyceride fraction (an ester of glycerol and fatty acids that occurs naturally as fats and fatty oi

How can the fermentation explain the origin of muscle cramps, How can the k...

How can the knowledge about fermentation explain the origin of muscle cramps and pains after intense physical exertion? A typical fermentation process because of oxygen scarcit

What is oxygen-haemoglobin dissociation curve, What is oxygen-haemoglobin d...

What is oxygen-haemoglobin dissociation curve? Explain the role of red blood cells in the transport of oxygen and carbon dioxide by blood. Briefly describe the principle, pr

Investigation of tricuspid regurgitation by echo doppler, Q. Investigation ...

Q. Investigation of Tricuspid regurgitation by Echo Doppler? Investigations ECG in secondary TR shows evidence of right atrial overload and right ventricular hypertrophy

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What are the five human digestive secretions, What are the five human diges...

What are the five human digestive secretions? Which of them is the only one that does not contain digestive enzymes? The human digestive secretions such as: saliva, gastric jui

What is the mendel observations and conclusions, How would Mendel's observa...

How would Mendel's observations and conclusions have been dissimilar if many of the characteristics he studied, such as seed color and seed texture, had been controlled by genes lo

How many cellular nuclei does the pollen tube have, How many cellular nucle...

How many cellular nuclei does the pollen tube of angiosperms have? What is the ploidy of each of these nuclei? The pollen tube that is the mature male gametophyte of angiosperm

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd