Excretory system, Biology

Assignment Help:
What are the excretory organ in protozoa,coelenterates, insects,spider,and arthropods

Related Discussions:- Excretory system

Secretion of parathormone and calcium blood level, Q. What is the relation ...

Q. What is the relation between secretion of parathormone and the calcium blood level? The parathormone increases the calcium blood level since it stimulates the resorption (re

Explain the term- cerebral ischemia, Explain the term- Cerebral Ischemia ...

Explain the term- Cerebral Ischemia Ischemia refers to any of a group of disorders in which the symptoms are caused by vessel blockage preventing a sufficient supply of blood t

Explain the type I diabetes mellitus, What the difference is between type I...

What the difference is between type I diabetes mellitus and type II diabetes mellitus? Type I diabetes, also called as juvenile diabetes, or insulin-dependent diabetes (this na

Define the history of food microbiology, Normal 0 false false...

Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4

What are the digestive functions of the liver, Q. What are the digestive fu...

Q. What are the digestive functions of the liver? The liver has other digestive functions, besides making bile for release in the duodenum. The venous network that absorbs n

What are the temporal factors of abnormality, What are the Temporal Factors...

What are the Temporal Factors of Abnormality Given the on going schedule of postnatal neurodevelopment, the age of the child at the time of exposure and the behaviour can have

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Determine the role as antioxidant, Determine the Role as antioxidant? S...

Determine the Role as antioxidant? Some carotenoids, in addition to serving as a source of vitamin A, have been shown lo function as antioxidants. Studies show that lycopene. (

Determine the bone density, Bone Density The compact bone surrounding d...

Bone Density The compact bone surrounding dense evenly spaced trabeculae with small cancellous spaces is ideal/suitable for implant placement. Dense or porous cortical bone is

Embryological evidences of evolution, EMBRYOLOGICAL EVIDENCES - A co...

EMBRYOLOGICAL EVIDENCES - A comparative study of embryology of different groups of animals reveals certain features that provide evidences for organic evolution. There ar

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd