Excretory system, Biology

Assignment Help:
Excretory organs of agama lizard

Related Discussions:- Excretory system

What is a nutrient, What is a nutrient? A nutrient is it substance used...

What is a nutrient? A nutrient is it substance used in the metabolism and which is acquired from the diet. Such as, vitamins and necessary amino acids are nutrients.

What is taxonomic diversity, Q. What is Taxonomic diversity? Taxonomic ...

Q. What is Taxonomic diversity? Taxonomic diversity is relative abundance of a species as well as the ancestor descendant relationships of species to each other. For example, a

Thymus, THYMU S - It is derived from the endoderm of the embryo. S...

THYMU S - It is derived from the endoderm of the embryo. Structur e . The thymus gland is located in the upper part of the thorax near the heart. It is a soft, pinkish, b

Amnion adaptation to terrestrial life, Q. Why can the amnion also be consid...

Q. Why can the amnion also be considered an adaptation to terrestrial life? The amnion is as well an adaptation to dry land since one of its functions is to prevent desiccation

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Concept of punctuated equilibrium, A species of trilobite was found in the ...

A species of trilobite was found in the fossil record. At its first appearance, it is similar to an ancestor species but differs from the ancestor in several key characteristics. I

Veterinary medicine have to do with physiology, What does veterinary medici...

What does veterinary medicine have to do with physiology and biochemistry? A lot of Physiology will teach about the function of animals and their parts. This is very significan

Behavioural adjustments, Behavioural Adjustments When faced with a su...

Behavioural Adjustments When faced with a sudden temperature change, most animals make behavioural responses that enable them to avoid extreme or lethal conditions. Among the

Mechanism of regulation, A number of protein-coding genes are active in all...

A number of protein-coding genes are active in all cells and are required for so- called house-keeping functions such as the enzymes of glycolysis, the citric acid cycle and the pr

Solid or liquid at room temperature, do fats with one or more 'kinky' tail ...

do fats with one or more 'kinky' tail fatty acids tend to be solid or liquid at room temperature? These are found in triglycerides forming what? Solid fats or oils? Is it opposite

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd