Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain about the primary protein derivatives? a) Proteins: These are the insoluble products which result from the incipient action of very dilute acids or enzymes. e.g. casein
HISTORY OF THE CELL Term "Cytology" was given by Hertwig , he also wrote a book on " Cell and Tissue ". Father of cytology = Robert Hooke. Father of Modern cytology
Which are plant tissues that cover the stem and the leaves? The stem perhaps covered by epidermis (having stomata, cuticle and photosynthetic cells) as in monocots or, alternat
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. What do you mean by hydraulic modelling? Modelling is neither new nor relevant to hydraulic engineering only. It is practiced in the field of hydraulic machinery for testing
What are risk factors for diseases? Risk factors for a disease are everything that contributes to enhance the risk of the disease to appear. For instance, for most cardiovascul
Explain Sickle cell anemia If 4% of a people are born with a severe form of sickle cell anemia. what percent of population will be resistant to malaria in spite of carrying
Water Pollution Water is one of the most essential requirements for the survival of all living organisms. Water is used for household, agricultural, industrial and recreation
Explain the following terms in detail - Homology, Homologous ? Structures that have a similar evolutionary origin however different functions. The wing of a bat and a whale's fl
Describe the Supra Cardiac Type of TAPVC ? After connecting the baby to cnrdiopulmonary bypass, the common pulmonary venous channel is dissected. This lies behind the left atr
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd