excretory organs, Biology

Assignment Help:
The excretory organs and excretory materials of plants and animals

Related Discussions:- excretory organs

Excretory system - ureters, URETERS From hilum of each kidney emerge...

URETERS From hilum of each kidney emerges out a tube. Wall is thick. Lumen is star shaped. 28 cm. long. Transitional epithelium present in wall. Open in to urinary bla

What is metachronal wave. describe., What is Metachronal wave? Describe. ...

What is Metachronal wave? Describe. During the coordination of the ciliary movement, bands, or groups of cilia, are at different stages of their beating pattern, and this creat

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Define criteria for assessment of niacin status, Define Criteria for Assess...

Define Criteria for Assessment of Niacin Status? Niacin status can be monitored by daily urinary excretion of methylated metabolites, especially the ratio of the 2-pyridone to

Define classification of proteins on the basis of attributes, Define Classi...

Define Classification of proteins on the basis of attributes? Besides classifying proteins on the basis of soluble and insoluble, proteins have been further classified based on

Types of heart failure, The various types and their description of Heart fa...

The various types and their description of Heart failure are as follows:  Left Sided Versus Right Sided Heart Failure   Predominantly left sided failure is seen in left ventr

Transport system in higher animals, Transport system in higher animals ...

Transport system in higher animals The circulatory system in higher animals has undergone several changes during evolution. The heart has become totally muscular. It p

New Technology, What is the best microscope to get a detailed view of the p...

What is the best microscope to get a detailed view of the parts inside of a preserved plant cell

Calculate the amount of oxygen - microbial survival, Calculate the Amount o...

Calculate the Amount of Oxygen - Microbial Survival and Growth? The amount of oxygen in the environment influences the microbial growth. Depending on the oxygen requirement, yo

Explain environmental resistance and the population growth, What is the rel...

What is the relationship among environmental resistance and the population growth according to the biotic potential curve and the real population growth curve? The difference

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd