excretory organs, Biology

Assignment Help:
classification of excretory organs in helminthes, nermatodes, annelids, molluscs, arthropods and echinodems

Related Discussions:- excretory organs

Explain the nutrient requirements during lactation, Normal 0 fa...

Normal 0 false false false EN-IN X-NONE X-NONE

Gymnosperm affinities, basic difference beyween gymnosperm,angiosperm and p...

basic difference beyween gymnosperm,angiosperm and pteridophytes.

Chemical agents available for sterilization, Q. Chemical Agents Available f...

Q. Chemical Agents Available for Sterilization? Chemical Agents: these include the following: Alcohols: ethyl alcohol, isopropyl alcohol, trichlorobutanol Aldehydes: f

What is suppuration, Suppuration High number of PMN cells have been det...

Suppuration High number of PMN cells have been detected around implants that are associated with severe signs of mucosal inflammation. Several studies have shown the presence o

Explain the phase contrast microscope, Explain the Phase Contrast Microscop...

Explain the Phase Contrast Microscop? Unpigmented and unstained living cells can be easily observed by phase contrast microscope. It has a special objective and a condenser th

Breeder select for in a cereal crop, What characteristics might a breeder s...

What characteristics might a breeder select for in (i) a cereal crop, (ii) a farm animal? (i) In a cereal variety, a breeder might select for high yield; disease-, frost- or dr

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Scientific methord, how adoctor dicide a sickness of a patiant

how adoctor dicide a sickness of a patiant

Energy requirement during congestive cardiac failure, Q. Energy requirement...

Q. Energy requirement during congestive cardiac failure? Energy: Composition of the calorie requirements on the basis of body weight is usually not feasible due to the presence

Quantitative real-time pcr, 1. You are given a pair of primers that has bee...

1. You are given a pair of primers that has been shown amplify a 125 bp DNA of interest specifically by a end point PCR- as there was only one PCR product with a size of 125 bp det

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd