Evolutionary changes in humans, Biology

Assignment Help:

Evolutionary changes that occurred in humans are -

Development of prominent chin. Increase in cranial capacity. Reduction of brow-ridges.
Development of speech. Development of community life. Reduction in the size of teeth.
Reduction of muscles. Gradual development of thumb opposability. Development of shorter fore limbs.
Liberation of hands for locomotory function. Slow assumption of erect posture.

Related Discussions:- Evolutionary changes in humans

How are the antibodies against the rh factor formed, How are the antibodies...

How are the antibodies against the Rh factor formed? The Anti-Rh antibodies are made by humoral immune response. When the Rh- individual makes contact with the Rh factor this i

Experiment the test for limestone, The test for limestone You can chec...

The test for limestone You can check the rock samples to see if any are limestone by dropping lemon juice, vinegar or some other dilute acid on them. If any are limestone they

How can i become involved in supporting brain research, How can I become in...

How can I become involved in supporting brain research? A. Here are some ways which you can support brain research: Join in activities of Brain Awareness Week. Dona

Conditions do most seeds need in order to begin germination, a) What condit...

a) What conditions do most seeds need in order to begin germination? b) What other condition do the seedlings need to continue growth to mature plants? a) Most seed

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What are proteins, What are proteins? How can the protein diversity of livi...

What are proteins? How can the protein diversity of living beings be explained? Proteins are molecules made of sequences of amino acids bound by a peptide bond. The genetic

Medical therapy for tricuspid stenosis, Q. Medical therapy for tricuspid st...

Q. Medical therapy for tricuspid stenosis? Medical therapy is ineffective. With diuretics, symptoms of congestion are replaced by that of low cardiac output state. Occasional c

Define principle for iodine number estimation - lipids, Define Principle fo...

Define Principle for Iodine Number Estimation - Lipids? Iodine number is defined as the number of grams of iodine absorbed by 100 grams of fat, it gives an idea of the relative

Hormones of pancreas, HORMONE S OF PANCREAS AND THEIR ROLE - (i) Glu...

HORMONE S OF PANCREAS AND THEIR ROLE - (i) Glucagon (Secreted by a-cells) It stimulates the liver to convert stored glycogen into glucose. Glucagon is controlled b

Exstrophy of the bladder, Exstrophy of the Bladder This is the most c...

Exstrophy of the Bladder This is the most common major congenital defect of lower urinary and genital tract. This is found more frequently in males than in females. Exstr

Write Your Message!

Name

Email id

Message

Verfication Code

User Account

All Pages