Evolutionary changes in humans, Biology

Assignment Help:

Evolutionary changes that occurred in humans are -

Development of prominent chin. Increase in cranial capacity. Reduction of brow-ridges.
Development of speech. Development of community life. Reduction in the size of teeth.
Reduction of muscles. Gradual development of thumb opposability. Development of shorter fore limbs.
Liberation of hands for locomotory function. Slow assumption of erect posture.

Related Discussions:- Evolutionary changes in humans

Indications for surgery-pericardial diseases, Indications for Surgery : O...

Indications for Surgery : Once diagnosis of constrictive pericarditis is made and confirmed by chest X-ray, ECG, echocardiogram, CT, MRI scan, cardiac catheterisation and angio,

Dna, diagram of dna replication

diagram of dna replication

Artificial insemination, ARTIFICIAL INSEMINATION - Artificial insemi...

ARTIFICIAL INSEMINATION - Artificial insemination is a technique to make a female pregnant by artificially introducing semen into the vagina. Artificial insemination has

Genetic engineering, steps in genetic engineering

steps in genetic engineering

What are the advantages of intra oral periapical radiographs, Advantages of...

Advantages of Intra Oral Periapical Radiographs a) It is a useful high yield modality for ruling out local bone or dental disease b) It is of value in identifying critical

Describe the functionality of implant material, Functionality of implant ma...

Functionality of implant material It should take maximum advantage of available bone and permit the maximum amount of forces to be transmitted through the implant within physio

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain procedure for performing the completed coliform test, Explain Proce...

Explain Procedure for Performing the Completed Coliform Test? Completed test is the last step in the Coliform test procedure which is described herewith. Conduct the exercise f

Explain about bone lining cells, Explain about Bone lining cells Bone ...

Explain about Bone lining cells Bone lining cells are basically inactive osteoblasts (in terms of making bone) that line bone surfaces. Osteocytes are osteoblasts that have be

Pollination, Pollination Many flowering plants rely on animals such as b...

Pollination Many flowering plants rely on animals such as bees, butterflies, moths, wasps, beetles, birds, and bats for pollination to produce fruit. Thirty percent of our food

Write Your Message!

Name

Email id

Message

Verfication Code

User Account

All Pages