Evolutionary Biology-Genetic Drift, Biology

Assignment Help:
Imagine a population evolving by genetic drift in which the frequency of allele K is 0.65. What is the probability that at some point in the future allele K will drift to a frequency of 1?

Related Discussions:- Evolutionary Biology-Genetic Drift

What is the law of limiting factors, What is the law of limiting factors? H...

What is the law of limiting factors? How would the rate of photosynthesis be affected if the soil water becomes limiting? Describe.

What do you mean by linnaeus binomial system, Q. What do you mean by Linnae...

Q. What do you mean by Linnaeus binomial system? Almost a century after Bauhin the great Swiss naturalist Carolus Linnaeus (1707-1778) published the two monumental works the "S

Explain the diarrhoeal management strategies, Explain the Diarrhoeal Manage...

Explain the Diarrhoeal Management Strategies? The diarrhoeal management strategies have had a major impact on less than 5 mortality rate. The distribution of ORS packets and ne

Admission information - nursing, Admission Information   The physician ...

Admission Information   The physician and nurses are the primary source of facts concerning the purpose of therapeutic plan and expected outcome of hospitalization. The informa

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Vitality and vigour - qualitative characters, Vitality and Vigour - Qualita...

Vitality and Vigour - Qualitative Characters Vitality is related to the condition of a plant and its capacity to complete its life cycle, while vigor refers more specifically

Application of derivative, Give some real world sample problem involving us...

Give some real world sample problem involving use of derivative

Explain prevention of endocarditis, Explain prevention of endocarditis ...

Explain prevention of endocarditis Many physicians believe that antimicrobial prophylaxis before process that may cause transient bacteremia can stop endocarditis and prostheti

Define the protective of vitamin c role as an antioxidant, Define the Prote...

Define the Protective of Vitamin C role as an antioxidant? Vitamin C is a powerful antioxidant because it can donate a hydrogen atom and form a relatively stable ascorbyl free

Annelids - hormones in growth and reproduction, Annelids - Hormones in Grow...

Annelids - Hormones in Growth and Reproduction Studies on polychaetes have displayed that the endocrine glands play a key role in growth and reproduction. In addition to the b

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd