What is the Evolution of migration, Biology

Assignment Help:

Evolution of migration

Eg

  • Benefits associated with migratory flights must be greater than those associated with staying in Alaska and having to tolerate seasonal changes.
  • Selective advantage linked to evolution of migration e.g. reduction in competition; improved environmental conditions; greater reproductive success must have resulted from selection for migration.
  • Evolution of migration is linked to the improved survival of the species, despite the energy requirements of the migratory journey.
  • Consideration of such factors as range expansion due to competition and / or changing environmental conditions, increased breeding success at fringes of range (but return to seasonal feeding grounds during non-breeding season), or accidental, eg blown off course.
  • Increasing selection for those birds that possessed physiological responses to environmental cues for migration, eg birds that depart before food availability, photoperiod or temperatures decrease.
  • Similar pressures at new destination forced migratory populations / birds back to origin.
  • May have occurred when landmasses were joined / closer together, flight distances shorter, staging sites more frequent. Continental drift then selected those best adapted for longer flights.

 


Related Discussions:- What is the Evolution of migration

Human respiratory system - larynx, LARYN X - Study of larynx is kno...

LARYN X - Study of larynx is known as Laryngeology. In man it is more prominent than woman known as Adam's apple. It is sound producing organ. At its base trachea presen

Define some essential facts about the fats, Define some Essential facts abo...

Define some Essential facts about the Fats? 1) Fats are essential in diets to facilitate satiety, high-energy intakes, and absorption of fat-soluble vitamins and provide essent

Medical management of meningitis , Medical Management Trealment of ch...

Medical Management Trealment of choice is cephalosporin which is given interavenously, alternatively can be given. In case of increased intra cranial pressure mannitol and o

Coronal disassembly-endodontics principles and practice, Coronal Disassembl...

Coronal Disassembly -If the existing restoration functionally designed well fitting and esthetically pleasing , -The access the pulp chamber during retreatment is better app

Define vitamins b12 deficiency in vegans, Define Vitamins B 12 Deficiency ...

Define Vitamins B 12 Deficiency in Vegans? Because plants do not synthesize vitamin B 12 , individuals who consume diets completely free of animal products (vegan diets) are a

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Dna and rna, why uracil is present in rna and thymine in dna?

why uracil is present in rna and thymine in dna?

What is a bio regenerative system, What is a bio regenerative system? Why i...

What is a bio regenerative system? Why is it essential? Nutritional requirements for long flights have been refined, placing more demands on food development. Despite the techn

Class turbellaria, plz answer me how I arrange my topic with its order ?

plz answer me how I arrange my topic with its order ?

Strawberry slain - common disorders of skin, Strawberry Slain: It  sig...

Strawberry Slain: It  signfies the dilatation  of deeper vessels  to form  cavernous spaces like those seen  in  the erectile tissue of the penis. The  lesion  is well-defined

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd