Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Take the prepared slide of Euglena and focus it first under low power and next under the high power of tlie microscope. Observe tlie following characteristics:
i) Euglena is an oval spindle shaped organism with a blunt anterior end and a pointed posterior end.
ii) Body is externally covered with a pellicle.
iii) Underneath the pellic le the cytoplasm is clearly differentiated into an outer ectoplasm and an inner endoplasm.
iv) Anterior end of the body bears an opening cytostome, which continues illternally as a tubular cytopharynx. The cytopllarynx leads into a large splier ical reservoir.
v) From the base of the reservoir a single whip-like flagellum arises.
vi) A single large spherical nucleus is located towards the posterior region of the body.
Q. Etiological factors involved in short bowel syndrome? The etiological factors involved in this disease are: • Anaemia • Osteoporosis • Stone formation • Decrease
Phases of Water The state of water can be changed from gaseous to liquid and liquid to solid and vice versa by the addition or removal of heat energy. To convert one gram of li
How does the intensity of facilitated diffusion vary in relation to the concentration of the moved substance? What is the limiting factor? Like simple diffusion facilitated dif
Give three examples of reflex actions. Examples of reflex actions are alter in size of the pupil of the eye in response to light intensity, blinking in response to foreign par
which type of cleavage takes place in centrolecithal egg
Define Proteins as regulators of water balance? As substrates and solutes are transferred or exchanged across membranes, water has a tendency to follow to maintain equal osmoti
Provide the Definition of Health Care? Health care involves much more than just medical care and can be defined as "multitude of services provided to individuals or communities
Q. Describe the rationale behind sterilization? Rationale for sterilization: Source of potential infection that exists in dental office include hands, saliva, nasal secretion,
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
The diet prescription The diet prescription designates the type, amount and frequency of feeding based on an individual's disease process and disease management goals. The dis
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd