Euglena, Biology

Assignment Help:

Take the prepared slide of Euglena and focus it first under low power and next under the high power of tlie microscope. Observe tlie following characteristics:

i) Euglena is an oval spindle shaped organism with a blunt anterior end and a pointed posterior end.

ii) Body is externally covered with a pellicle.

iii) Underneath the pellic le the cytoplasm is clearly differentiated into an outer ectoplasm and an inner endoplasm.

iv) Anterior end of the body bears an opening cytostome, which continues illternally as a tubular cytopharynx. The cytopllarynx leads into a large splier ical reservoir.

v) From the base of the reservoir a single whip-like flagellum arises.

vi) A single large spherical nucleus is located towards the posterior region of the body.


Related Discussions:- Euglena

Etiological factors involved in short bowel syndrome, Q. Etiological factor...

Q. Etiological factors involved in short bowel syndrome? The etiological factors involved in this disease are: • Anaemia • Osteoporosis • Stone formation • Decrease

Phases of water, Phases of Water The state of water can be changed from...

Phases of Water The state of water can be changed from gaseous to liquid and liquid to solid and vice versa by the addition or removal of heat energy. To convert one gram of li

How does the intensity of facilitated diffusion differ, How does the intens...

How does the intensity of facilitated diffusion vary in relation to the concentration of the moved substance? What is the limiting factor? Like simple diffusion facilitated dif

Give three examples of reflex actions, Give three examples of reflex action...

Give three examples of reflex actions. Examples of reflex actions are alter in size of the pupil of the eye in response to light intensity, blinking in response to foreign par

Centrolecithal egg, which type of cleavage takes place in centrolecithal eg...

which type of cleavage takes place in centrolecithal egg

Define proteins as regulators of water balance, Define Proteins as regulato...

Define Proteins as regulators of water balance? As substrates and solutes are transferred or exchanged across membranes, water has a tendency to follow to maintain equal osmoti

Provide the definition of health care, Provide the Definition of Health Car...

Provide the Definition of Health Care? Health care involves much more than just medical care and can be defined as "multitude of services provided to individuals or communities

Describe the rationale behind sterilization, Q. Describe the rationale behi...

Q. Describe the rationale behind sterilization? Rationale for sterilization: Source of potential infection that exists in dental office include hands, saliva, nasal secretion,

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain the diet prescription, The diet prescription The diet prescrip...

The diet prescription The diet prescription designates the type, amount and frequency of feeding based on an individual's disease process and disease management goals. The dis

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd