Etiology, Biology

Assignment Help:

M protein of rheumatogenic GAS has distinct structural characteristics that are akin to human heart tissue, particularly sarcolemmal membrane proteins and cardiac myosin. The major factors that lead to risk of ARF are the severity of the immune response to GAS pharyngitis and persistence of GAS organisms during convalescence. A very small proportion (0.3-3 per cent) of patients suffering from GAS throat infection ultimately develop ARF and this along with a familial predisposition of ARF points to a genetic susceptibility. However, in our Indian patients a genetic linkage to HLA DR3 in patients, with ARF has been demonstrated. For confirmation of the initial diagnosis of acute rheumatic fever, evidence of prior GAS infection is required. Several rapid GAS antigen tests are available. Majority of these tests has a high degree of specificity but low level of sensitivity in clinical practice.

However, it must be stressed that a negative test does not rule out the GAS infection in the throat. At the same time in presence of a positive antigen test and positive throat culture, it is difficult to distinguish between a recent infection which can be associated with ARF and chronic carrier of GAS infection with ARF. Elevated or rising ASO titres (> 250Todd units in adults and >333 Todd units in children) are more reliable evidence of recent GAS infection than a positive culture or positive rapid antigen test and such titres are also significant for diagnosis.


Related Discussions:- Etiology

What is suturing technique, Normal 0 false false false ...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Describe what happens during activation of the lac operon, Describe what ha...

Describe what happens during activation of the lac operon. Lactose binds to the repressor protein, which causes the repressor protein to be released from the operator site. Th

Animals of the open water zone, Animals of the open water zone The li...

Animals of the open water zone The limnetic region of this zone contains certain fishes as well as rotifers, zooplankton such as crustacean and protozoan. In the profundal zo

What is osteogenesis, Osteogenesis The term osteogenesis describes esse...

Osteogenesis The term osteogenesis describes essentially two distinctly different phenomena by which bone can become juxtaposed to an implant surface.

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Radiation sterilization, introduction of an assignment about radiation ster...

introduction of an assignment about radiation sterilization

Name of structures you would expect to find in the dermis, Name of the stru...

Name of the structures you would expect to find in the dermis. In the dermis you would expect to search sensory nerve endings, nerve fibres, capillaries, arterioles and venules

Mycoplasmosi, MYCOPLASMOSIS Mycoplasma organisms are the smallest free li...

MYCOPLASMOSIS Mycoplasma organisms are the smallest free living, lack of cell-wall and bounded by a triple layer of plasma membrane. The organisms are pleuomorphic in shape, viz.

What is rigor mortis, Q. What is rigor mortis? Dead bodies are at first...

Q. What is rigor mortis? Dead bodies are at first limp. Many hours after death, skeletal muscles undergo a partial contraction that fixes the joints. This condition, called rig

Chronic mitral regurgitation-indications for surgery, Chronic Mitral Regurg...

Chronic Mitral Regurgitation :  In chronic mitral regurgitation, the asymptomatic phase is much longer than in mitral stenosis. Onset of symptoms may also mean the onset of l

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd