Etiology, Biology

Assignment Help:

Etiology
The infectious agent of psittacosis - lymphogranuloma venerum trachoma group (PLVG) is an obligate intracellular parasite and is classified as separate genera with only 2 species, viz. Chlamydia trachomatis and Chlamydia psittacii. These organisms are the members of an exclusive order Chlamydiales under the family Chlamydiaceae. The organism resembles bacteria in the composition of the cell wall, as it possesses both RNA and DNA and also multiply by binary fission. However, unlike bacteria, this multiplication occurs only within the host cells. In this respect, like viruses the organism is intracellular and can only be propagated or multiply in living cells. The elementary bodies of chlamydia stain with basic dyes and are visible as small, round red coloured dots with the light microscope when stained by the methods of Machiavello or Gimenez or modified acid-fast techniques. Their colour is purple blue in Giemenez stained preparations and appear Gram negative in Gram’s stained preparations.


Related Discussions:- Etiology

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Non-striated or smooth muscles, NONSTRIATED (= SMOOTH) MUSCLES - Non...

NONSTRIATED (= SMOOTH) MUSCLES - Non-striated muscles are found in the posterior part of oesophagus, stomach, intestine, lungs, urinogenital tract, urinary bladder, blood ve

Pathophysiology and assessment of patent ductus arteriosus, Pathophysiology...

Pathophysiology   If  the ductus arteriosus does not close after birth, the higher pressure in the aorta than in the pulmonary artery causes the blood to flow from the aorta, t

Molecules that make possible active transport, Which are the molecules that...

Which are the molecules that make possible active transport through membranes? Ans) Active transport is made by particular membrane proteins. These proteins are known as "pumps"

Endosperm - pollen biology, Endosperm - Pollen Biology The examination...

Endosperm - Pollen Biology The examination of live material of j. montana reveals that the division of the primary endosperm nucleus is transverse, followed by the laying down

What is the original concentration, A sample of yeast cells was serially di...

A sample of yeast cells was serially diluted 1/10 five times then serially diluted 1/3. the number of yeasts was338 yeasts per ml. what was the original concentration? Please show

One benefit of including vegetable fibre in the diet, State one benefit of ...

State one benefit of including vegetable fibre (roughage) in the diet   Vegetable fibre retains water (keeping the faeces soft and bulky), stops constipation, decreases the

What is the objectives of genesis of coronary artery disease, What is the o...

What is the objective of genesis of coronary artery diseases and risk factors ? After reading this unit, you should be able to: Understand the genesis of CAD; 1 learns about th

Determine about the accommodation of eye, Determine about the Accommodation...

Determine about the Accommodation of eye Accommodation is the ability of the overall refracting power of the eye to change to clearly view objects at different distances. This

Explain the peptones - complex media, Explain the Peptones - Complex Media?...

Explain the Peptones - Complex Media? Peptones are protein hydrolysates obtained by partial digestion of meat, casein, soya meal, gelatin or other protein source. These provide

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd