Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
EtiologyThe infectious agent of psittacosis - lymphogranuloma venerum trachoma group (PLVG) is an obligate intracellular parasite and is classified as separate genera with only 2 species, viz. Chlamydia trachomatis and Chlamydia psittacii. These organisms are the members of an exclusive order Chlamydiales under the family Chlamydiaceae. The organism resembles bacteria in the composition of the cell wall, as it possesses both RNA and DNA and also multiply by binary fission. However, unlike bacteria, this multiplication occurs only within the host cells. In this respect, like viruses the organism is intracellular and can only be propagated or multiply in living cells. The elementary bodies of chlamydia stain with basic dyes and are visible as small, round red coloured dots with the light microscope when stained by the methods of Machiavello or Gimenez or modified acid-fast techniques. Their colour is purple blue in Giemenez stained preparations and appear Gram negative in Gram’s stained preparations.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
NONSTRIATED (= SMOOTH) MUSCLES - Non-striated muscles are found in the posterior part of oesophagus, stomach, intestine, lungs, urinogenital tract, urinary bladder, blood ve
Pathophysiology If the ductus arteriosus does not close after birth, the higher pressure in the aorta than in the pulmonary artery causes the blood to flow from the aorta, t
Which are the molecules that make possible active transport through membranes? Ans) Active transport is made by particular membrane proteins. These proteins are known as "pumps"
Endosperm - Pollen Biology The examination of live material of j. montana reveals that the division of the primary endosperm nucleus is transverse, followed by the laying down
A sample of yeast cells was serially diluted 1/10 five times then serially diluted 1/3. the number of yeasts was338 yeasts per ml. what was the original concentration? Please show
State one benefit of including vegetable fibre (roughage) in the diet Vegetable fibre retains water (keeping the faeces soft and bulky), stops constipation, decreases the
What is the objective of genesis of coronary artery diseases and risk factors ? After reading this unit, you should be able to: Understand the genesis of CAD; 1 learns about th
Determine about the Accommodation of eye Accommodation is the ability of the overall refracting power of the eye to change to clearly view objects at different distances. This
Explain the Peptones - Complex Media? Peptones are protein hydrolysates obtained by partial digestion of meat, casein, soya meal, gelatin or other protein source. These provide
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd