Ethological isolation, Biology

Assignment Help:

Members belonging to different species refrain from mating because of the behavioural differences between them. Such behavioural differences usually centre around specific courtship patterns which the species have evolved. The behaviour patterns are more conspicuous in animals rather than in plants. And among animals, once again, the courtship behaviour is more pronounced among terrestrial and fresh water organisms than in marine forms. Mayr points out that in those forms where there is an elaborate courtship behaviour the interspecific hybrids are rare. Closely related species that do not have pair-binding courtship rituals do commonly give rise to hybrids. Mayr is of the opinion that in species where there is a courtship behaviour pattern, the "engagement" may be broken if the pairs do not belong to the same species, A detailed study of the courtship behaviour of six species of Drosophila showed that courtship and mating could be divided into six phases. If there is incompatibility at any one of these six phases, the potential mates break off and the courtship is discontinued. Under laboratory conditions, the interspecific crosses have not been successful and the courtship was terminated even in the first stage. What is more interesting here is that even to a trained observer differences in courtship behaviour exhibited by different species may appear to be trivial and insignificant. But the species recbgnise the specific signals and respond suitably. In certain other forms differences in courtship behaviour between species could be very pronounced, The courtship dances of the different species of Uca (shore crab) could be recognised from a distance. This is also true of mating dances of salamanders, turtles and birds.


Related Discussions:- Ethological isolation

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Brain neurosecretory cells and their hormones, Brain Neurosecretory Cells a...

Brain Neurosecretory Cells and their Hormones Kopec was the very first to suggest the role of hormones in controlling metamorphosis. On the base of his experiments on the lar

What are other organs and tissues made from that germ layer, From which ger...

From which germ layer do the epidermis and the nervous system originate? What are other organs and tissues made from that germ layer? Epidermis and nervous system have the simi

Does the dna replication occur in the cell division, Q. Does the DNA replic...

Q. Does the DNA replication occur in the cell division? Yes. The DNA replication occurs in mitosis as well in the meiosis.

Temperate deciduous forests, Going south of taiga you would reach the tempe...

Going south of taiga you would reach the temperate regions of the planet. These regions experience moderate temperatures on average that change during four distinct seasons. They h

Continuous suture technique-prosthetic aortic valve, Continuous suture tec...

Continuous suture technique: Monofilament 2'0' prolene sutures, which slide through easily, are used for this technique. three double armed prolene sutures are taken and with val

What are the technique of operation cardiovascular surgery, What are the Te...

What are the Technique of Operation Cardiovascular Surgery? Technique of Operation Cardiovascular Surgery :  The operation is done on cardiopulmonary bypass with profound h

Explain water soluble vitamins for infants, Explain Water soluble vitamins ...

Explain Water soluble vitamins for Infants? Thiamin, riboflavin and niacin requirements are met through breast milk alone and solely breast-fed infants meet their requirements.

Newton, meaning of the law of inertia

meaning of the law of inertia

Explain about the various cooking methods, Explain about the various Cookin...

Explain about the various Cooking methods? All of us eat food either raw or in cooked form. Have you ever thought why we need to cook food?  Cooking is a primary process to mak

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd