Essential for photosynthesis, Biology

Assignment Help:

Aim : To prove that light is essential for photosynthesis.
Apparatus : A potted plant, a light screen, beaker, iodine solution.
Procedure : Keep a potted plant in darkness for two days to make us sure that the leaves are free from starch. Attach a light screen to one of the leaves. The light screen holds the leaf by a lid. The lid has a cut design like a star water the plant and keep it in sunlight for 4 or 5 hours keep in mind that the leaf with light screen receives sunlight on the leaf through the cut design in the lid.
Then detach the leaf from the plant and remove light screen. Test the leaf for starch using iodine solution.
Observation : You will see blue colour only in the area which received the sunlight. This area resembles the cut design on the lid of the light screen. Rest of leaf is colourless.
Inference : In blue coloured portion only carbohydrates are present. That means the part of the leaf which received sunlight performed photosynthesis. Rest of the leaf remained colourless due to non-performance of photosynthesis. 

Conclusion : From the above experiment, it is clear that light is essential for photosynthesis.
Precautions : The potted plant should be kept in darkness for two days or three days.

595_essential for photosynthesis.png


Related Discussions:- Essential for photosynthesis

Explain about the classification of fungi, Explain about the Classification...

Explain about the Classification of Fungi? The fungi, as you may recall reading above, is now placed in a separate kingdom called Myceteae. Traditionally, fungi were divided in

Types of surgery in exstrophy of the bladder, Types of Surgery   There ...

Types of Surgery   There may be two options for surgical correction. Urinary Diversion In this following procedures are performed:  1)  Uretero sigrnoidostomy  if there  is

Plant, what is the scientific explanation of "touch me not" plant that can ...

what is the scientific explanation of "touch me not" plant that can react due to any touch

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Use of computer in biotechnology, what are the uses of computer in biotechn...

what are the uses of computer in biotechnology ??? briefly explain any twenty

Role of protein in metabolism, ROL E OF PROTEIN - Main organic comp...

ROL E OF PROTEIN - Main organic component of body. Unit is amino acid. Polymer of amino acids. Amino acids combine to each other by peptide bond. Formation of bone, t

What is respiration quotient, a) Where casparian strips situated in a plant...

a) Where casparian strips situated in a plant body are and what are they made up of? Mention its function. b) What is respiration quotient (RQ)? Under what conditions will th

Cyanotic heart disease, Cyanotic Heart Disease In  this there is a com...

Cyanotic Heart Disease In  this there is a communication between Pulmonary and systemic circulation through which venous blood enters the systemic circulatory system. The infa

Ways in which genetic recombination occurs during meiosis, Define two ways ...

Define two ways in which genetic recombination occurs during meiosis. Genetic recombination happens during crossing- over and independent assortment.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd