Erysipelas, Biology

Assignment Help:

Erysipelas

A sudden onset of infection with the bacterium Erysipelothrix insidiosa (E. rhusiopathiae) is seen in turkeys and increasingly in free-range chickens. It may be transmitted by carrier birds or animals like pigs or sheep. The bacteria are resistant to environmental effects or disinfectants and may persist in alkaline soil for years.

Symptoms and lesions: Inappetance, depression and sleepiness are the initial signs. There may be diarrhea and respiratory signs as well as perineal congestion and chronic scabby skin in some cases.  Hemorrhages in fat, muscles and epicardium as well as swelling of liver, kidney and spleen are seen. The whole carcass may be congested. Marked catarrhal enteritis, endocarditis may also be noted.

Diagnosis: Isolation and identification of causative agent on blood agar and the demonstration of the organism in stained impression smears from tissues is generally adequate for diagnosis.

Prevention and control: Strict biosecurity along with good nutrition and management are the basic requirements to prevent entry of infection from pigs and its further spread in a flock.


Related Discussions:- Erysipelas

Gas transportation systems in animals, Q. Oxygen comes from the environment...

Q. Oxygen comes from the environment and carbon dioxide in the end returns to the environment. How do small animals solve the problem of taking away and bringing these molecules fr

What do you mean by trachea, Q. Why doesn't the food enter the trachea inst...

Q. Why doesn't the food enter the trachea instead of going to the esophagus? When food is swallowed the swallow reflex is activated and the larynx closes and elevates to avoid

Gastro epiploic artery and inferior epigastric artery, Gastro Epiploic arte...

Gastro Epiploic artery GEA is seldom used now. Patency has been reported as 94 per cent at one year, 88 per cent at five years and 83 per cell1 at ten years. Inferior Epiga

What is thyroid disease, Q. What is thyroid disease? Thyroid disease: T...

Q. What is thyroid disease? Thyroid disease: Thyroid disease is associated with angina. Anginas pectoris presents itself in the form of speific symptoms which tend to re- oc

What is the lipid profile control, Lipid profile control Evaluation of ...

Lipid profile control Evaluation of lipid profile is essential to the management of diabetes and should be performed at initial visit in all patients with diabetes.  You have l

Workplace exposure limits, Question 1: What are the heat-induced disord...

Question 1: What are the heat-induced disorders that may result from excessive exposure to a hot working environment? How can we alleviate such health problems? Question 2:

Determine lamellar compaction and remodeling, Lamellar compaction and remod...

Lamellar compaction and remodeling (6 to 18 weeks) A remodeling phase is initiated in which hematopoietic-derived osteoclastic cells form cutting cones will remove the establis

In which area dietitians works, In which area Dietitians works Dietitia...

In which area Dietitians works Dietitians can work in a variety of areas, as already mentioned earlier, many of these are in the  Hospitals or in  the community  as  'Clinical

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

ANAT 260 Signature Assignment, ANAT 260 Signature Assignment Instructions: ...

ANAT 260 Signature Assignment Instructions: Address each question below as it relates to the case study given. A patient was brought to the Emergency Department by ambulance with t

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd