Erysipelas, Biology

Assignment Help:

Erysipelas

A sudden onset of infection with the bacterium Erysipelothrix insidiosa (E. rhusiopathiae) is seen in turkeys and increasingly in free-range chickens. It may be transmitted by carrier birds or animals like pigs or sheep. The bacteria are resistant to environmental effects or disinfectants and may persist in alkaline soil for years.

Symptoms and lesions: Inappetance, depression and sleepiness are the initial signs. There may be diarrhea and respiratory signs as well as perineal congestion and chronic scabby skin in some cases.  Hemorrhages in fat, muscles and epicardium as well as swelling of liver, kidney and spleen are seen. The whole carcass may be congested. Marked catarrhal enteritis, endocarditis may also be noted.

Diagnosis: Isolation and identification of causative agent on blood agar and the demonstration of the organism in stained impression smears from tissues is generally adequate for diagnosis.

Prevention and control: Strict biosecurity along with good nutrition and management are the basic requirements to prevent entry of infection from pigs and its further spread in a flock.


Related Discussions:- Erysipelas

Deficiency diseases-metabolic disorders, Metabolic Disorders The disea...

Metabolic Disorders The disease conditions, which are attributable to an imbalance between rates of input of dietary nutrients and the output of production, are defined as pro

Factors that affects oxygen dissociation curves, Factors that affects Oxyge...

Factors that affects Oxygen Dissociation Curves Oxygen dissociation curve for a sample of blood is affected by several factors. The most important of them are: Te

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

State the variety of chemical and biological reactions, State the Variety o...

State the Variety of chemical and biological reactions Variety of chemical and biological reactions takes place leading to the formation of the solution phase. If we analyse th

What is bone remodeling, Bone Remodeling Bone remodeling differs from t...

Bone Remodeling Bone remodeling differs from the other means of bone structure alteration in that osteoblasts and Osteoclasts do not act independently but are coupled and bone

Animal reproduction, Animal Reproduction - Reproduction is the ability ...

Animal Reproduction - Reproduction is the ability to produce new organism of its own type. It is meant to increase their number. Reproduction includes - (i) Replication o

How to use atp to make reactions go, What do enzymes do, and how? How is en...

What do enzymes do, and how? How is enzyme activity regulated in cells? How do ATPases u se ATP to make reactions go?

What does an osteoblast cell do, What does an osteoblast cell do? Livin...

What does an osteoblast cell do? Living cells within the bone are occupied in an unceasing process of remodeling. Osteoblasts lining the surface of bone are much like fibroblas

Explain the mechanisms of endosseous integration, Mechanisms Of Endosseous ...

Mechanisms Of Endosseous Integration Three terms may be used to describe individual aspects of bone formation process that can occur around implants. They are Osteoconduction,

What is rearrangement reaction, PREPARATION OF BENZILIC ACID 1.  What i...

PREPARATION OF BENZILIC ACID 1.  What is rearrangement reaction? The reactions in which the carbon of the molecule is rearranged to give a structural isomer of the original

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd