Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Erysipelas
A sudden onset of infection with the bacterium Erysipelothrix insidiosa (E. rhusiopathiae) is seen in turkeys and increasingly in free-range chickens. It may be transmitted by carrier birds or animals like pigs or sheep. The bacteria are resistant to environmental effects or disinfectants and may persist in alkaline soil for years.
Symptoms and lesions: Inappetance, depression and sleepiness are the initial signs. There may be diarrhea and respiratory signs as well as perineal congestion and chronic scabby skin in some cases. Hemorrhages in fat, muscles and epicardium as well as swelling of liver, kidney and spleen are seen. The whole carcass may be congested. Marked catarrhal enteritis, endocarditis may also be noted.
Diagnosis: Isolation and identification of causative agent on blood agar and the demonstration of the organism in stained impression smears from tissues is generally adequate for diagnosis.
Prevention and control: Strict biosecurity along with good nutrition and management are the basic requirements to prevent entry of infection from pigs and its further spread in a flock.
Q. Oxygen comes from the environment and carbon dioxide in the end returns to the environment. How do small animals solve the problem of taking away and bringing these molecules fr
Q. Why doesn't the food enter the trachea instead of going to the esophagus? When food is swallowed the swallow reflex is activated and the larynx closes and elevates to avoid
Gastro Epiploic artery GEA is seldom used now. Patency has been reported as 94 per cent at one year, 88 per cent at five years and 83 per cell1 at ten years. Inferior Epiga
Q. What is thyroid disease? Thyroid disease: Thyroid disease is associated with angina. Anginas pectoris presents itself in the form of speific symptoms which tend to re- oc
Lipid profile control Evaluation of lipid profile is essential to the management of diabetes and should be performed at initial visit in all patients with diabetes. You have l
Question 1: What are the heat-induced disorders that may result from excessive exposure to a hot working environment? How can we alleviate such health problems? Question 2:
Lamellar compaction and remodeling (6 to 18 weeks) A remodeling phase is initiated in which hematopoietic-derived osteoclastic cells form cutting cones will remove the establis
In which area Dietitians works Dietitians can work in a variety of areas, as already mentioned earlier, many of these are in the Hospitals or in the community as 'Clinical
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
ANAT 260 Signature Assignment Instructions: Address each question below as it relates to the case study given. A patient was brought to the Emergency Department by ambulance with t
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd