Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Erysipelas
A sudden onset of infection with the bacterium Erysipelothrix insidiosa (E. rhusiopathiae) is seen in turkeys and increasingly in free-range chickens. It may be transmitted by carrier birds or animals like pigs or sheep. The bacteria are resistant to environmental effects or disinfectants and may persist in alkaline soil for years.
Symptoms and lesions: Inappetance, depression and sleepiness are the initial signs. There may be diarrhea and respiratory signs as well as perineal congestion and chronic scabby skin in some cases. Hemorrhages in fat, muscles and epicardium as well as swelling of liver, kidney and spleen are seen. The whole carcass may be congested. Marked catarrhal enteritis, endocarditis may also be noted.
Diagnosis: Isolation and identification of causative agent on blood agar and the demonstration of the organism in stained impression smears from tissues is generally adequate for diagnosis.
Prevention and control: Strict biosecurity along with good nutrition and management are the basic requirements to prevent entry of infection from pigs and its further spread in a flock.
Q. Define Direct Visualisation of Coronary Arteries? Ans. Coronary arteries cad be directly visualized using two-dimensional echocardiography, especially in patients with
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Explain The working of Senses: Touch, Hearing, Equilibrium ? The senses are detected by sense organs, collections of receptor cells, or cells closely associated with them. A m
green gland is excretory organ of which ortopodic phylem
Question 1 What is antimicrobial resistance? List the reasons for antimicrobial resistance. Explain why antimicrobial resistance is a global concern. Add a note on various mechani
What about foam stability? Foam stability can be determined by two factors i.e. drainage and bubble size. The volume of the liquid drained due to gravitational forces when foam
What is the structure into which the follicle is transformed after ovulation? What is the importance of that structure in the menstrual cycle? The follicle that released the ov
How is synthesis of soluble proteins taking equatorial part on the surface of lens? Synthesis of soluble proteins taking equatorial part on the surface of lens as follows: 1
Define role of Vitamin A in controlling gene expression? Vitamin A as retinoic acid has widespread effects on the synthesis of a variety of important proteins. These diverse ef
Auxiliary Food Chains In addition to grazing and detritus food chains there are other auxiliary food chains operated through parasites and scavengers. Some parasitic food chai
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd