Erysipelas, Biology

Assignment Help:

Erysipelas

A sudden onset of infection with the bacterium Erysipelothrix insidiosa (E. rhusiopathiae) is seen in turkeys and increasingly in free-range chickens. It may be transmitted by carrier birds or animals like pigs or sheep. The bacteria are resistant to environmental effects or disinfectants and may persist in alkaline soil for years.

Symptoms and lesions: Inappetance, depression and sleepiness are the initial signs. There may be diarrhea and respiratory signs as well as perineal congestion and chronic scabby skin in some cases.  Hemorrhages in fat, muscles and epicardium as well as swelling of liver, kidney and spleen are seen. The whole carcass may be congested. Marked catarrhal enteritis, endocarditis may also be noted.

Diagnosis: Isolation and identification of causative agent on blood agar and the demonstration of the organism in stained impression smears from tissues is generally adequate for diagnosis.

Prevention and control: Strict biosecurity along with good nutrition and management are the basic requirements to prevent entry of infection from pigs and its further spread in a flock.


Related Discussions:- Erysipelas

Define direct visualisation of coronary arteries, Q. Define Direct Visualis...

Q. Define Direct Visualisation of Coronary Arteries? Ans. Coronary arteries cad be directly visualized using two-dimensional echocardiography, especially in patients with

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain the working of senses: touch, Explain The working of Senses: Touch,...

Explain The working of Senses: Touch, Hearing, Equilibrium ? The senses are detected by sense organs, collections of receptor cells, or cells closely associated with them. A m

Zooology, green gland is excretory organ of which ortopodic phylem

green gland is excretory organ of which ortopodic phylem

What is antimicrobial resistance, Question 1 What is antimicrobial resista...

Question 1 What is antimicrobial resistance? List the reasons for antimicrobial resistance. Explain why antimicrobial resistance is a global concern. Add a note on various mechani

What about foam stability, What about foam stability? Foam stability ca...

What about foam stability? Foam stability can be determined by two factors i.e. drainage and bubble size. The volume of the liquid drained due to gravitational forces when foam

What is the importance of that structure in menstrual cycle, What is the st...

What is the structure into which the follicle is transformed after ovulation? What is the importance of that structure in the menstrual cycle? The follicle that released the ov

Synthesis of soluble proteins on the surface of lens, How is synthesis of s...

How is synthesis of soluble proteins taking equatorial part on the surface of lens? Synthesis of soluble proteins taking equatorial part on the surface of lens as follows: 1

Define role of vitamin a in controlling gene expression, Define role of Vit...

Define role of Vitamin A in controlling gene expression? Vitamin A as retinoic acid has widespread effects on the synthesis of a variety of important proteins. These diverse ef

Auxiliary food chains, Auxiliary Food Chains In addition to grazing an...

Auxiliary Food Chains In addition to grazing and detritus food chains there are other auxiliary food chains operated through parasites and scavengers. Some parasitic food chai

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd