Epididymis, Biology

Assignment Help:

EPIDIDYMIS -

  1. All seminiferous tubules form short straight tubules as tubuli recti, open into wider network of rete testis.
  2. From rete testis 15-20 fine convoluted tubules, the vasa efferentia are given out open in caput epididymes.
  3. The vasa efferentia is lined by pseudo stratified epithelium.
  4. Epididymis a part of embryonic kidney originated from wolffian duct.
  5. It is very coiled, 6m. long, commonly known as store house of sperms.
  6. Sperm can be seen for 10 Hr. to 10 days in it.
  7. In epididymis caput (globus minor) corpus (main body) and cauda (globus major) present.
  8. From cauda part vasa deferentia is originated where sperms are more active.

Related Discussions:- Epididymis

Explain which provides barrier to the movement of molecules, In a plasma me...

In a plasma membrane, which of the below provides a general barrier to the movement of molecules? a) Lipids b) Proteins c) Carbohydrates d) all of these Answer: a

Explain the adverse effects of menactra, Adverse effects of menactra The...

Adverse effects of menactra The most common adverse reactions to Menactra include headache, fatigue and malaise, in addition to pain, redness and induration at the site of injec

Signal transduction, What is the initial concentration of Beta-adrenergic r...

What is the initial concentration of Beta-adrenergic receptor in blood?

Explain three basic sexual life cycles studied in biology, What are the thr...

What are the three basic sexual life cycles studied in Biology? Which of them corresponds to metagenesis? Which of them is the human life cycle? Sexual reproduction may take pl

Clinical features - infective endocarditis, The clinical  manifestations of...

The clinical  manifestations of IE result from the local destructive effects of intracardiac infection; the embolization of bland or septic fragments of vegetations to

Haccp - what is validation, HACCP - What is Validation Validation   : ...

HACCP - What is Validation Validation   :  That element of verification focused on collecting and evaluating scientific and technical information to determine  if  the HACCP

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd