Ephemeral fever, Biology

Assignment Help:

Ephemeral fever

It is also known as three days sickness and affected animals suffer from pyrexia, muscular stiffness and lameness.

Etiology: The disease is caused by ephemeral fever virus that belongs to rhabdoviridae family. Most of the cases occur in hot and humid environmental conditions and when the mosquito population is high.

Pathogenesis: After entering into circulation, virus multiplies and localizes in the mesodermal tissue such as muscles and joints. There is inflammation of the tissue causing pain and muscle stiffness.

Clinical signs: The infected animals show sudden high rise of body temperature, anorexia and reduction in milk yield. There is increase in the heart and respiration rate, and nasal and ocular discharge. Swelling over muscle area of shoulder, back and neck, shivering, stiffness and clonic muscular movements are noticed. The lameness is also very prominent and animal adopt typical posture of laminitis. Occasionally, animal shows lateral recumbency. Abortions occur in pregnant animals. After 3 days, the body temperature becomes almost normal and they start eating and ruminating.

Hematological analysis reveals leukocytosis, neutrophilia with shift to the left, lymphopenia and increased fibrinogen levels are noticed along with hypocalcemia. Postmortem examination shows accumulation of serofibrinous exudate in synovial, pericardial, pleural and peritoneal cavities. The lymph nodes are enlarged and swollen.

Diagnosis: The disease is diagnosed by clinical signs and examination of blood, and confirmed by serological tests like agar gel precipitation, fluorescent antibody, ELISA and complement fixation tests. It should be differentiated from laminitis, parturient paresis and traumatic reticulitis. In laminitis, there is local pain in feet and this may occur due to excess carbohydrate feeding while parturient paresis usually occurs after parturition and cases respond well to calcium therapy. Traumatic reticulitis can be detected by metal detector if caused by metallic object and its course is quite long. If it is not caused by metallic object, its diagnosis is possible by cardinal signs, X-ray examination and rumenotomy.

Treatment: As the symptoms disappear in 3 days, so usually supportive treatment is recommended. The affected animals are given drugs to relieve the temperature and muscle stiffness. So, paracetamol and phenylbutazone are given by parenteral route. Top recent secondary bacterial infection, broad spectrum antibiotics like streptopenicillin or tetracycline are given.

Control: There is no vaccine available against the disease. The only way to reduce its occurrence is by adopting hygienic measures and reducing the vector population.


Related Discussions:- Ephemeral fever

Charles darwin was the first person, Charles Darwin was the first person to...

Charles Darwin was the first person to suggest that: a. the present forms of all existing species are the result of natural selection b. species have changed over long periods of t

What is meant by concentration gradient, What is meant by concentration gra...

What is meant by concentration gradient? Is it correct to refer to "concentration gradient of water"? Concentration gradient is the difference of concentration of a substance

Types of tissue have the greatest capacity to regenerate, Q. Which types of...

Q. Which types of tissue have the greatest capacity to regenerate? Epithelial and connective tissues have the greatest capacity to regenerate. In injuries andsmall wounds, epit

Write short note on cholesterol, Cholesterol, from stereos (solid) and the...

Cholesterol, from stereos (solid) and the Greek chole- (bile) followed by the chemical suffix -ol for an alcohol is an organic chemical substance classified as a waxy steroid of fa

Define body mass index (bmi), Define Body Mass Index (BMI)? Weight for ...

Define Body Mass Index (BMI)? Weight for height as a marker of nutritional status has the advantage that it is independent of other factors that affect foetal outcome such as m

Defense mechanisms used in diabetes mellitus, Q. Defense mechanisms used in...

Q. Defense mechanisms used in Diabetes Mellitus? Defense mechanisms are the strategies to cope with the real situation and to maintain self-image. Healthy persons normally use

How can heart be affect, How can Heart be affect Heart may be affected ...

How can Heart be affect Heart may be affected in two ways. One of the complications of diabetes is autonomic dysfunction which may disturb rhythm of heart beat and may lead to

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Vitamin - a, VITAMIN - A Discovered by Macollum. Also known as ...

VITAMIN - A Discovered by Macollum. Also known as Retinol / Antixeropthalmic vitamin / Auxerophthol. It is vitamin for normal vision. It forms retinal pigments rho

Explain national nutritional anaemia prophylaxis programme, Explain Nationa...

Explain National Nutritional Anaemia Prophylaxis Programme? National Nutritional Anaemia Prophylaxis Programme addresses iron and folate deficiency anaemia (IDA). Preschoolers

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd