Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
If an enzyme-controlled reaction normally takes place at 10ºC, in general terms how will the reaction be affected by (a) a fall in temperature to 2°C , (b) a rise in temperature to 20°C. (c) a rise in temperature to 65°C?
If an enzyme normally works at 10°C, then
(a) A fall in temperature to 2°C will slow down the reaction
(b) A rise in temperature to 20°C will speed up the reaction (by x2)
(c) A rise in temperature to 65°C will denature the enzyme and stop it working (by the reaction might be speed up at first).
Define Determinants of Food Security - Food Utilization? It is the proper biological use of food, requiring a diet providing sufficient energy and essential nutrients, potable
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. Understanding Behaviour of diabetic patients? Beliefs Each of us has a set of beliefs that were learned by us when we were young. These include religious beliefs and
explain spermatogenesis
Q. What are the two divisions of meiosis and what are the major events that occur in those divisions? Meiosis is divided into first meiotic division, or meiosis I, and second m
What are gametes? Gametes are cells specialized in sexual reproduction. They have half of the maximum number of chromosomes of the species and unite with another gamete giving
what are golgi apparatus
How is the nervous system characterized in beings of the phylum Annelida? How can one compare cephalization in annelids to cephalization in nematodes and platyhelminthes? Annel
Which are the beings that form the kingdom Animalia? What are the two big groups into which this kingdom is divided? The kingdom Animalia is the animal kingdom. Commonly the ki
Iron deficiency Iron plays an essential role in oxygen transport in the body as a constituent of haemoglobin where nearly 60% of the body iron is found. Apart from oxygen tran
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd