Enzyme-controlled reaction, Biology

Assignment Help:

If an enzyme-controlled reaction normally takes place at 10ºC, in general terms how will the reaction be affected by  (a) a fall in temperature to 2°C , (b) a rise in temperature to 20°C. (c) a rise in temperature to 65°C?

If an enzyme normally works at 10°C, then

   (a) A fall in temperature to 2°C will slow down the reaction

   (b) A rise in temperature to 20°C will speed up the reaction (by x2)

   (c) A rise in temperature to 65°C will denature the enzyme and stop it working (by the reaction might be speed up at first).

 


Related Discussions:- Enzyme-controlled reaction

Define determinants of food security - food utilization, Define Determinant...

Define Determinants of Food Security - Food Utilization? It is the proper biological use of food, requiring a diet providing sufficient energy and essential nutrients, potable

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Understanding behaviour of diabetic patients, Q. Understanding Behaviour of...

Q. Understanding Behaviour of diabetic patients? Beliefs  Each of us has a set of beliefs that were learned by us when we were young. These include religious beliefs and

Explain two divisions of meiosis, Q. What are the two divisions of meiosis ...

Q. What are the two divisions of meiosis and what are the major events that occur in those divisions? Meiosis is divided into first meiotic division, or meiosis I, and second m

What are gametes, What are gametes? Gametes are cells specialized in s...

What are gametes? Gametes are cells specialized in sexual reproduction. They have half of the maximum number of chromosomes of the species and unite with another gamete giving

Cells, what are golgi apparatus

what are golgi apparatus

Explain cephalization in nematodes and platyhelminthes, How is the nervous ...

How is the nervous system characterized in beings of the phylum Annelida? How can one compare cephalization in annelids to cephalization in nematodes and platyhelminthes? Annel

Which are the beings that form the kingdom animalia, Which are the beings t...

Which are the beings that form the kingdom Animalia? What are the two big groups into which this kingdom is divided? The kingdom Animalia is the animal kingdom. Commonly the ki

Deficiency diseases-iron deficiency, Iron deficiency Iron plays an ess...

Iron deficiency Iron plays an essential role in oxygen transport in the body as a constituent of haemoglobin where nearly 60% of the body iron is found. Apart from oxygen tran

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd