Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Define the effect of Deficiency of Vitamin C? Severe ascorbic acid deficiency results in the development of the disease known as scurvy, three important manifestations of scur
Define Vitamins required for underweight - nutritional care? If the diet provides good amounts of fresh fruits and vegetables, vitamin or mineral supplements are usually not re
CARBOHYDR A TES Carbohydrate = hydrate of carbon. Hydroxyl group present. Aldehyde group or keto group may present. Carbohydrates are polyhydroxy aldehydes
What is the excretory organ of an agama lizard?
Chemical Stress - Nature of the solutes The acidic or basic reaction of soil and water of a particular habitat reflects its geochemical history beginning with its formation an
Nutrition chat
The citric acid cycle functions in the mitochondria of eukaryotes and in the cytosol of prokaryotes. The Succinate dehydrogenase, the only membrane-bound enzyme in t
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. What is phosphorylation? What are various biological processes in which phosphorylation plays a critical role? Phosphorylation is the name given to procedure of the addition
FUNCTIO N OF LIPIDS Fats are storage products of both plants and animals. I n plants , fats are commonly stored in spores and seeds while in animals they are sto
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd