enzyme, Biology

Assignment Help:
types of enzyme

Related Discussions:- enzyme

Define the effect of deficiency of vitamin c, Define the effect of Deficien...

Define the effect of Deficiency of Vitamin C? Severe ascorbic acid deficiency results in the development of the disease known as scurvy, three important manifestations of scur

Define vitamins required for underweight - nutritional care, Define Vitamin...

Define Vitamins required for underweight - nutritional care? If the diet provides good amounts of fresh fruits and vegetables, vitamin or mineral supplements are usually not re

Carbohydrates, CARBOHYDR A TES Carbohydrate = hydrate of carbo...

CARBOHYDR A TES Carbohydrate = hydrate of carbon. Hydroxyl group present. Aldehyde group or keto group may present. Carbohydrates are polyhydroxy aldehydes

Excretory system, What is the excretory organ of an agama lizard?

What is the excretory organ of an agama lizard?

Chemical stress - nature of the solutes, Chemical Stress - Nature of the so...

Chemical Stress - Nature of the solutes The acidic or basic reaction of soil and water of a particular habitat reflects its geochemical history beginning with its formation an

Cytosol of prokaryotes, The  citric  acid  cycle  functions  in  the  mitoc...

The  citric  acid  cycle  functions  in  the  mitochondria   of  eukaryotes  and  in  the cytosol of prokaryotes. The Succinate dehydrogenase, the only membrane-bound enzyme   in t

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What is phosphorylation, Q. What is phosphorylation? What are various biolo...

Q. What is phosphorylation? What are various biological processes in which phosphorylation plays a critical role? Phosphorylation is the name given to procedure of the addition

Function of lipids, FUNCTIO N OF LIPIDS Fats are storage products ...

FUNCTIO N OF LIPIDS Fats are storage products of both plants and animals. I n plants , fats are commonly stored in spores and seeds while in animals they are sto

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd