Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
This technique utilizes an enzyme resolvase, endo vii, cloned from the bacteriophage t4. This enzyme has high specificity to find deletions, insertions, and base substitutions mutations or any mismatches. First the pcr is utilized to intensify the normal and mutant allele of targeted sequence, these pcr primers are labeled with fam(6-carboxyfluoroscein amidite) which is a blue fluorescent dye and reverse primer with tet(4,7,2,7-tetra chloro-6-carboxy fluoroscein) amidite which is a green fluorescent dye.
Denaturation and renaturation of normal and mutant allele in a mixture is made, consequently mismatch heteroduplexes will form about 50 % of the time, each and every base pair creates two mismatch. The endo vii enzymes then scan the double stranded dna until it finds structural distortion, either a bubble made by single base pair mutations or a hetero duplex loop created by hybridization of a wild type allele with a mutant allele having an insertion or deletion. The enzyme cleaves with in 6 base pair on 3"side of mutation creating two smaller fragments, one blue and the other one green. The dna sequence is analyzed on automated dna sequence and mobility of every fragment is analyzed.
Q. Show the Apical View of Transducer Position? For the patient with dextrocardia transducer is kept on right chest with marker towards left side. Morphological parameters to
Influenza Influenza is an acute infectious disease caused by influenza viruses of genus Orthomyxovirus in family Orthomyxoviridae. The name Influenza is derived from an Italian ph
Explain Procedure for Analysis of Air of Processing Facility? Now conduct the experiment following the steps enumerated herewith: 1. Label the Petri plates with nutrient aga
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
The NYQUIST LIIMIT-It is a sampling phenomenon, which limits the maximum fiequemcy shift measurement to one half of the sampling frequency (PRF). By its nature, pulse wave
Define Advantages for underwater weighing method? This method is currently considered the "gold standard in percent body fat measurement (with the coming up of DEXA, the de
What is Knot tying Once the suture is satisfactorily placed, it must be secured with a knot. The instrument tie is used most commonly in cutaneous surgery. The square knot is t
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What are the main human diseases caused by fungi? The main human diseases caused by fungi are coccidioidomycosis, histoplasmosis, blastomycosis, paracoccidioidomycosis, or Sout
Describe about Psycho-social Change in children? Adolescence is a period of maturation for both mind and body. Along with the physic4 growth, emotional and intellectual develop
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd