environmental issues, Biology

Assignment Help:
what is the bioindicator of water pollution.

Related Discussions:- environmental issues

Biology , Biology : Biology may be defined the study of living organisms. I...

Biology : Biology may be defined the study of living organisms. It mainly deals with the characteristics of living organisms and their classification. It is also concerned with the

Sterility assurance, All the efforts that go into the preparation of instru...

All the efforts that go into the preparation of instruments are futile if the sterilization process itself is not successful. There is no way of seeing that instruments are sterile

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Absorption, Absorption The monosaccharides, amino acids and other prod...

Absorption The monosaccharides, amino acids and other products of digestion must be passed on to other tissues to be useful for the organism. The process by which the digested

Define energy and protein requirement in geriatric nutrition, Define Energy...

Define Energy and Protein requirements in geriatric nutrition? Decreased physical activity and changes in body composition and decreased basal metabolic rate affects the ma

Effects of malnutrition, Effects of malnutrition The effects of maln...

Effects of malnutrition The effects of malnutrition are not the same in adults and children. When the amount of food is not sufficient or when the nutrients are missing f

Determine effects of probiotics on animals, Determine Effects of probiotics...

Determine Effects of probiotics on Animals? Let us briefly examine the effects that have been reported (remember most of it has been on animals): 1. In animals, probio

What are symptoms found in patients with hyperthroidism, What are some sign...

What are some signs and symptoms found in patients with hyperthyroidism? The hormones made by the thyroid gland stimulate the basal metabolism of the body. In hyperthyroidism t

What are the two divisions of the angiosperms, What are the two divisions o...

What are the two divisions of the angiosperms? The angiosperms are separated into monocotyledonous and dicotyledonous. (These categories are defined later in this text.) Pla

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd