Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Which of the following represents two things that are identical? a.Two alleles for the same gene in a homologous chromosome pair. b.The sequences of DNA in the two sister chr
importance of pyramid of energy to the ecologist
Define Inhibitors and Enhancers - absorption of dietary iron? Phytates and fibre from whole grain cereals, tannins and polyphenols in tea, oxalates in green leafy vegetables li
Define Limitations of Agar Syringe or Agar Sausage Method? (i) It is applicable to surfaces with low contaminants. (ii) Problem of spreading colonies may occur. (iii) Col
Q. Explain about Climate Regulation? By giving off moisture through their leaves and providing shade, plants help keep us and other animals cool. Forests are especially good cl
Give one example in each case of the usefulness of bacteria in (a) a natural environment, (b) an industrial process. (a) In a natural environment bacteria brin
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
what is life span
Explain Heat Preservation - Method of Food Preservation? The process of heating was used centuries before its action was understood. Food is heated up or cooked. Heat kills mi
Q. How Drying used for sterilization? Moisture is essential for bacteria, drying therefore has a deleterious effect on most bacteria. Spontaneous drying can often kill bacteria
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd