Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. What is the path followed by the energy absorbed by plants to be used in photosynthesis?
The energy source of photosynthesis is the sun, the central and unique star of our planetary system. In photosynthesis the solar energy is transformed into chemical energy, the energy of the chemical bonds of the produced glucose molecules and of the released molecular oxygen. The energy of glucose is then stored as starch glucose polymer or it is used in the cellular respiration process and transferred to ATP molecules. ATP is consumed in metabolic processes that spend energy (for instance, blocked transport across membranes).
In 1809, Maggiolo described a process of fabricating and inserting gold roots into freshly extracted sockets. The implant was constructed from the three pieces of gold which were s
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. After the blastula stage what is the following stage of the embryonic development? What is the passage from blastula to the next stage called? The blastula turns into gastru
Feeding on Small Particles Microscopic algae and bacteria can be taken in directly into the cell by the digestive vacuoles. But one of the most successful methods of feeding o
Define Criteria for Assessment of Pyridoxine Status? Vitamin B 6 status is most appropriately evaluated by using a combination of indicators, namely plasma PLP concentration,
X-Linked Traits in Humans Let us first examine traits determined by genes on the X-chromosome, or the X-linked traits. The human X chromosome contains many genes that are requi
ANTIBIOTICS - Chemicals produced by microorganism that inhibit the growth of other microorganism. Such microorganism which produces the antibiotics are antibiont . Wh
Composition - Culture Medium A standard plant tissue culture medium (Basal medium) contains all the essential macro elements (Carbon, hydrogen, oxygen nitrogen, phosphorus, su
Lateral Roots - Root Apex Lateral roots normally arise at a definite distance behind the tip from areas close to or opposite the points of xylem star. So, a triarch root can
(a) Find the electric potential, taking zero at infinity, at the upper right corner (the corner without a charge) of the rectangle in the figure. (Let y = 3.7 cm and x = 6.7 cm.)
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd