Energy, Biology

Assignment Help:

Energy

Contrary  to matter.  Energy neither occupies space, nor possesses mass. Hence it is defined, not on   physical ,but on operational or functional basis as the force which brings about a change or motion un matter of as capacity of magnetism, gravitation, sound, light, electricity, electromagnetic radiations, radiations, decayed, involved in the various events of nature are different manifestations of energy.

Under this definition, occurs in to phase potential and kinetic. Potential energy is stored energy, matter or energy of position of a material body. Kinetic energy is energy of emerge of action .i.e. active energy in the process of producing an effect in the matter and hence, doing work. To illustrate this potential energy gets stored in the leg of a football player when tjhe4 leg is raised and,  as the lag strikes the football, it turns into kinetic energy, giving  motion to the ball. Similarly kinetic energy spent on carrying a boulder uphill gets stored in the boulder as potential   energy of position. If now the boulder is pushed downhill motion to the boulder.

Energy exists in a number of different forms, such as heat sound electrical, mechanical radiant of light, of cosmic infra red and ultraviolet rays, and of X rays chemical, atomic, unclear energy.etc .Just  as potential emery can change into kinetic energy and versa any form of energy can convert  into any other form in both living and nonliving chemical systems .To  illustrate this ,let  take the example of steam locomotives  of a running train, burning coal in locomotive into the environment, but most of it issued in boiling water into steam, The potential heat energy of steam converts  into mechanical kinetic energy which give  motion to the l0comotive. A part of this mechanical energy is fed to a dynamo to be converted into electrical energy. The latter is then converted into light energy in the bulbs. Mechanical energy in  the fans and so on. Ultimately, all energy dissipates as heat into the environment.

Laws of Thermodynamics; In energy conversions, as cited above, the total amount of involved energy neither decreases nor increases .All energy spent in doing work is stored in the effect or product of the work. Thus energy can  be converted from one to the other for .but it can neither be destroyed, nor created anew..This is implies that the tidal energy content of the universe is constant

According to the second Law of Thermodynamic, some energy is essentially lost as dissipated heat in each energy conversion. That is why we feel hot near a railway engine or any other machine or an over or even a strong electric lamp Dissipation into the environment as heat is the ultimate fate f all kinetic energy.

Matter energy complex:  The so called electron shells in an atom have, in fact, no physical existence. They are simply different levels of potential energy in the form of electrons in an atom. It therefore implied that, while electrons, protons and negative neutrons are particulate units of matter, the electron shells are the non particulate unites or say units of energy.

Just as nucleus and electrons are bound n an atom by means of atomic energy, the atoms in a molecule are bound together by potential energy, called chemical or bond energy. By breaking the atoms a part, this energy can be liberated as kinetic energy.


Related Discussions:- Energy

Asymmetrical and spherical - metazoa, Asymmetrical and Spherical - Metazoa ...

Asymmetrical and Spherical - Metazoa Some creatures are asymmetrical: no matter which way we try to divide them through the middle, no two halves would appear alike. In simple

Explain about the forces acting on a gravity retaining wall, Explain about ...

Explain about the forces acting on a gravity retaining wall. Forces Acting on a Gravity Retaining Wall: In a general way the forces that act on a gravity retaining wall. The

Homologous recombination, Homologous Recombination is the exchange of the ...

Homologous Recombination is the exchange of the sequence between two associated but different DNA (or RNA) molecules, with the result that a new "chimeric" molecule is obtained. S

Structural differences between roots and shoots, What are the structural di...

What are the structural differences between roots and shoots? What structures are unique to each?

Symptoms of inflammatory bowel disease, Q. Symptoms of inflammatory bowel d...

Q. Symptoms of inflammatory bowel disease? Inflammatory bowel diseases are associated with: • Abdominal cramping, diarrhoea • Steatorrhoea • Obstruction caused due t

Chordata, what are the two main subdivisions of the phylum chordata

what are the two main subdivisions of the phylum chordata

Parasite and host during incubation period, Parasite and host during incuba...

Parasite and host during incubation period Incubation period is the second stage in the process of a disease. It is the time between the day of infection to the appearanc

Protozoa., show me the schamatic diagram of chrysomoeba?

show me the schamatic diagram of chrysomoeba?

Differentiation - morphogenesis and tissue organisation, Differentiation - ...

Differentiation - Morphogenesis and Tissue Organisation It should be clear to you that a single cell, the fertilized egg, gives rise to various structures that we mentioned. S

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd