Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What do you understand by Exoskeleton. Supporting structures of skeleton not surrounded by the body. Endoskeletal elements are secreted by an underlying epidermis and one side
C h oice of transgenic animal First and foremost is the selection of animal species in which gene of interest is to be transferred. Whatever is the goal of production of tran
DISSOCIATIVE (CONVERSION) DISORDERS: There is normally a considerable degree of conscious control over the memories and sensations that can be selected for immediate attentio
Biological Nitrogen-Fixation The process by which molecular nitrogen (N 2 ) is reduced to ammonia (NH 3 ) is called nitrogen-fixation (N 2 -fixation). This is the most importa
Define Essentiality of Nitrogen for Growth of Micro-Organism? Nitrogen is an essential atom in certain cellular macromolecules, e.g. amino acids, purines, pyrimidines, enzymes,
Explain about the Vitamin D? Vitamin D is a generic term and indicates a molecule of the general structure with rings (A, B, C, D), as you may have noticed in Figure B. The ri
recessive epistasis
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What is the significance of the epiglottis in human body? What happens to the glycogen concentration in the liver cells when the level of adrenaline enhances in the blood strea
Explain Fibre and Cardiovascular Disease (CVD)? The role-of dietary fibre in modulation of blood lipids was demonstrated by Keys and his co-workers in a series of experiments c
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd